ID: 1051957235

View in Genome Browser
Species Human (GRCh38)
Location 9:22711239-22711261
Sequence ATTCTGTTCTGGAGGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051957235_1051957239 20 Left 1051957235 9:22711239-22711261 CCTTGTTTCCTCCAGAACAGAAT No data
Right 1051957239 9:22711282-22711304 AACAATCGAAGTTGTGTCCAGGG No data
1051957235_1051957238 19 Left 1051957235 9:22711239-22711261 CCTTGTTTCCTCCAGAACAGAAT No data
Right 1051957238 9:22711281-22711303 CAACAATCGAAGTTGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051957235 Original CRISPR ATTCTGTTCTGGAGGAAACA AGG (reversed) Intergenic
No off target data available for this crispr