ID: 1051959551

View in Genome Browser
Species Human (GRCh38)
Location 9:22741687-22741709
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051959550_1051959551 -10 Left 1051959550 9:22741674-22741696 CCAAAATGGCTGAGAGGATTGCC No data
Right 1051959551 9:22741687-22741709 GAGGATTGCCTCTGAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051959551 Original CRISPR GAGGATTGCCTCTGAATAAC AGG Intergenic
No off target data available for this crispr