ID: 1051963704

View in Genome Browser
Species Human (GRCh38)
Location 9:22800695-22800717
Sequence TGGGAAAAAAGTGCCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051963699_1051963704 8 Left 1051963699 9:22800664-22800686 CCACATAGTAACCATAATTTAAC No data
Right 1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG No data
1051963700_1051963704 -3 Left 1051963700 9:22800675-22800697 CCATAATTTAACAGCCATCATGG No data
Right 1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG No data
1051963696_1051963704 24 Left 1051963696 9:22800648-22800670 CCTTCATCTTGTATCCCCACATA No data
Right 1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG No data
1051963697_1051963704 10 Left 1051963697 9:22800662-22800684 CCCCACATAGTAACCATAATTTA No data
Right 1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG No data
1051963698_1051963704 9 Left 1051963698 9:22800663-22800685 CCCACATAGTAACCATAATTTAA No data
Right 1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051963704 Original CRISPR TGGGAAAAAAGTGCCTTTGT AGG Intergenic
No off target data available for this crispr