ID: 1051966460

View in Genome Browser
Species Human (GRCh38)
Location 9:22834547-22834569
Sequence AGTTACCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051966460_1051966464 16 Left 1051966460 9:22834547-22834569 CCTGCCATCTTCTGCAGGTAACT No data
Right 1051966464 9:22834586-22834608 ACTGCCCTTTGCCTGTTACTGGG No data
1051966460_1051966463 15 Left 1051966460 9:22834547-22834569 CCTGCCATCTTCTGCAGGTAACT No data
Right 1051966463 9:22834585-22834607 GACTGCCCTTTGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051966460 Original CRISPR AGTTACCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr