ID: 1051970178

View in Genome Browser
Species Human (GRCh38)
Location 9:22878077-22878099
Sequence CAGCCAACAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051970173_1051970178 13 Left 1051970173 9:22878041-22878063 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG No data
1051970171_1051970178 23 Left 1051970171 9:22878031-22878053 CCTGCTGGATCCGGAGGGATGGA 0: 12
1: 72
2: 118
3: 157
4: 197
Right 1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG No data
1051970169_1051970178 24 Left 1051970169 9:22878030-22878052 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051970178 Original CRISPR CAGCCAACAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr