ID: 1051991421

View in Genome Browser
Species Human (GRCh38)
Location 9:23156869-23156891
Sequence TGGACATGCTGCAGCCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051991421_1051991425 15 Left 1051991421 9:23156869-23156891 CCCATAGGGCTGCAGCATGTCCA No data
Right 1051991425 9:23156907-23156929 ATTTCATTAAGTTAATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051991421 Original CRISPR TGGACATGCTGCAGCCCTAT GGG (reversed) Intergenic
No off target data available for this crispr