ID: 1051991425

View in Genome Browser
Species Human (GRCh38)
Location 9:23156907-23156929
Sequence ATTTCATTAAGTTAATTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051991421_1051991425 15 Left 1051991421 9:23156869-23156891 CCCATAGGGCTGCAGCATGTCCA No data
Right 1051991425 9:23156907-23156929 ATTTCATTAAGTTAATTCAGTGG No data
1051991423_1051991425 -5 Left 1051991423 9:23156889-23156911 CCAAGCACGAACCTCACAATTTC No data
Right 1051991425 9:23156907-23156929 ATTTCATTAAGTTAATTCAGTGG No data
1051991422_1051991425 14 Left 1051991422 9:23156870-23156892 CCATAGGGCTGCAGCATGTCCAA No data
Right 1051991425 9:23156907-23156929 ATTTCATTAAGTTAATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051991425 Original CRISPR ATTTCATTAAGTTAATTCAG TGG Intergenic