ID: 1051992322

View in Genome Browser
Species Human (GRCh38)
Location 9:23166410-23166432
Sequence TGTCTAATCCTGAAAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051992322_1051992323 -9 Left 1051992322 9:23166410-23166432 CCTCTCACTTTCAGGATTAGACA No data
Right 1051992323 9:23166424-23166446 GATTAGACAGATAATTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051992322 Original CRISPR TGTCTAATCCTGAAAGTGAG AGG (reversed) Intergenic
No off target data available for this crispr