ID: 1051999975

View in Genome Browser
Species Human (GRCh38)
Location 9:23266554-23266576
Sequence CAAGAGCTCCAGATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051999973_1051999975 27 Left 1051999973 9:23266504-23266526 CCACAGTGTTGTTATTTCTGAAG No data
Right 1051999975 9:23266554-23266576 CAAGAGCTCCAGATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051999975 Original CRISPR CAAGAGCTCCAGATTTCCCC AGG Intergenic