ID: 1052000472

View in Genome Browser
Species Human (GRCh38)
Location 9:23272799-23272821
Sequence AGAAATGTATGAACAGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052000472_1052000474 5 Left 1052000472 9:23272799-23272821 CCTATATCTGTTCATACATTTCT No data
Right 1052000474 9:23272827-23272849 CACAAACTTATCAGAGATGGAGG No data
1052000472_1052000473 2 Left 1052000472 9:23272799-23272821 CCTATATCTGTTCATACATTTCT No data
Right 1052000473 9:23272824-23272846 TGTCACAAACTTATCAGAGATGG No data
1052000472_1052000475 13 Left 1052000472 9:23272799-23272821 CCTATATCTGTTCATACATTTCT No data
Right 1052000475 9:23272835-23272857 TATCAGAGATGGAGGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052000472 Original CRISPR AGAAATGTATGAACAGATAT AGG (reversed) Intergenic
No off target data available for this crispr