ID: 1052001139

View in Genome Browser
Species Human (GRCh38)
Location 9:23282496-23282518
Sequence AGGTTGTTGTAGGTTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052001139_1052001145 23 Left 1052001139 9:23282496-23282518 CCATGGACAACCTACAACAACCT No data
Right 1052001145 9:23282542-23282564 TGTTTAAAAGTGTCATTTCCTGG No data
1052001139_1052001143 -1 Left 1052001139 9:23282496-23282518 CCATGGACAACCTACAACAACCT No data
Right 1052001143 9:23282518-23282540 TATAGGAGAATCACCTGCAGTGG No data
1052001139_1052001146 24 Left 1052001139 9:23282496-23282518 CCATGGACAACCTACAACAACCT No data
Right 1052001146 9:23282543-23282565 GTTTAAAAGTGTCATTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052001139 Original CRISPR AGGTTGTTGTAGGTTGTCCA TGG (reversed) Intergenic
No off target data available for this crispr