ID: 1052002044

View in Genome Browser
Species Human (GRCh38)
Location 9:23295685-23295707
Sequence TACTGGATAAGGCATGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052002035_1052002044 23 Left 1052002035 9:23295639-23295661 CCTATTTGATGGGCTAGGGATTG No data
Right 1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG No data
1052002036_1052002044 -2 Left 1052002036 9:23295664-23295686 CCCTCCCCTGAGAAATAGTTCTA No data
Right 1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG No data
1052002038_1052002044 -6 Left 1052002038 9:23295668-23295690 CCCCTGAGAAATAGTTCTACTGG No data
Right 1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG No data
1052002037_1052002044 -3 Left 1052002037 9:23295665-23295687 CCTCCCCTGAGAAATAGTTCTAC No data
Right 1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG No data
1052002041_1052002044 -8 Left 1052002041 9:23295670-23295692 CCTGAGAAATAGTTCTACTGGAT No data
Right 1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG No data
1052002040_1052002044 -7 Left 1052002040 9:23295669-23295691 CCCTGAGAAATAGTTCTACTGGA No data
Right 1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052002044 Original CRISPR TACTGGATAAGGCATGCGGA AGG Intergenic
No off target data available for this crispr