ID: 1052009667

View in Genome Browser
Species Human (GRCh38)
Location 9:23391116-23391138
Sequence GATCCACTTGATATTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052009667_1052009669 15 Left 1052009667 9:23391116-23391138 CCTGTGTGAATATCAAGTGGATC No data
Right 1052009669 9:23391154-23391176 ATAAGCAGTAGGAAAAAACATGG No data
1052009667_1052009668 4 Left 1052009667 9:23391116-23391138 CCTGTGTGAATATCAAGTGGATC No data
Right 1052009668 9:23391143-23391165 TAACAAATCACATAAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052009667 Original CRISPR GATCCACTTGATATTCACAC AGG (reversed) Intergenic
No off target data available for this crispr