ID: 1052009669

View in Genome Browser
Species Human (GRCh38)
Location 9:23391154-23391176
Sequence ATAAGCAGTAGGAAAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052009667_1052009669 15 Left 1052009667 9:23391116-23391138 CCTGTGTGAATATCAAGTGGATC No data
Right 1052009669 9:23391154-23391176 ATAAGCAGTAGGAAAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052009669 Original CRISPR ATAAGCAGTAGGAAAAAACA TGG Intergenic
No off target data available for this crispr