ID: 1052019804

View in Genome Browser
Species Human (GRCh38)
Location 9:23512588-23512610
Sequence AGGCCCACTCCTGCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052019804_1052019807 -10 Left 1052019804 9:23512588-23512610 CCAAAGGGAGCAGGAGTGGGCCT No data
Right 1052019807 9:23512601-23512623 GAGTGGGCCTGACAGCCTAGGGG No data
1052019804_1052019811 21 Left 1052019804 9:23512588-23512610 CCAAAGGGAGCAGGAGTGGGCCT No data
Right 1052019811 9:23512632-23512654 GAGTTGAAAAATCACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052019804 Original CRISPR AGGCCCACTCCTGCTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr