ID: 1052019807

View in Genome Browser
Species Human (GRCh38)
Location 9:23512601-23512623
Sequence GAGTGGGCCTGACAGCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052019803_1052019807 -9 Left 1052019803 9:23512587-23512609 CCCAAAGGGAGCAGGAGTGGGCC No data
Right 1052019807 9:23512601-23512623 GAGTGGGCCTGACAGCCTAGGGG No data
1052019804_1052019807 -10 Left 1052019804 9:23512588-23512610 CCAAAGGGAGCAGGAGTGGGCCT No data
Right 1052019807 9:23512601-23512623 GAGTGGGCCTGACAGCCTAGGGG No data
1052019797_1052019807 21 Left 1052019797 9:23512557-23512579 CCAATAATAGACATTGCACTAAC No data
Right 1052019807 9:23512601-23512623 GAGTGGGCCTGACAGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052019807 Original CRISPR GAGTGGGCCTGACAGCCTAG GGG Intergenic
No off target data available for this crispr