ID: 1052019811

View in Genome Browser
Species Human (GRCh38)
Location 9:23512632-23512654
Sequence GAGTTGAAAAATCACAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052019809_1052019811 -7 Left 1052019809 9:23512616-23512638 CCTAGGGGAGACCAAAGAGTTGA No data
Right 1052019811 9:23512632-23512654 GAGTTGAAAAATCACAGCAAAGG No data
1052019803_1052019811 22 Left 1052019803 9:23512587-23512609 CCCAAAGGGAGCAGGAGTGGGCC No data
Right 1052019811 9:23512632-23512654 GAGTTGAAAAATCACAGCAAAGG No data
1052019804_1052019811 21 Left 1052019804 9:23512588-23512610 CCAAAGGGAGCAGGAGTGGGCCT No data
Right 1052019811 9:23512632-23512654 GAGTTGAAAAATCACAGCAAAGG No data
1052019808_1052019811 1 Left 1052019808 9:23512608-23512630 CCTGACAGCCTAGGGGAGACCAA No data
Right 1052019811 9:23512632-23512654 GAGTTGAAAAATCACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052019811 Original CRISPR GAGTTGAAAAATCACAGCAA AGG Intergenic
No off target data available for this crispr