ID: 1052021082

View in Genome Browser
Species Human (GRCh38)
Location 9:23525915-23525937
Sequence AATGGTTGCCTAGCATAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052021077_1052021082 12 Left 1052021077 9:23525880-23525902 CCAACTAAAGCAATAATATGGGG No data
Right 1052021082 9:23525915-23525937 AATGGTTGCCTAGCATAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052021082 Original CRISPR AATGGTTGCCTAGCATAAAG AGG Intergenic
No off target data available for this crispr