ID: 1052022146

View in Genome Browser
Species Human (GRCh38)
Location 9:23537892-23537914
Sequence CATGCTAAGGGTAAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052022134_1052022146 6 Left 1052022134 9:23537863-23537885 CCCCCCAGTTGTGAGGCTTCATT No data
Right 1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG No data
1052022137_1052022146 3 Left 1052022137 9:23537866-23537888 CCCAGTTGTGAGGCTTCATTTAA No data
Right 1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG No data
1052022138_1052022146 2 Left 1052022138 9:23537867-23537889 CCAGTTGTGAGGCTTCATTTAAA No data
Right 1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG No data
1052022133_1052022146 12 Left 1052022133 9:23537857-23537879 CCGCTGCCCCCCAGTTGTGAGGC No data
Right 1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG No data
1052022136_1052022146 4 Left 1052022136 9:23537865-23537887 CCCCAGTTGTGAGGCTTCATTTA No data
Right 1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG No data
1052022135_1052022146 5 Left 1052022135 9:23537864-23537886 CCCCCAGTTGTGAGGCTTCATTT No data
Right 1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052022146 Original CRISPR CATGCTAAGGGTAAGGGAGG GGG Intergenic
No off target data available for this crispr