ID: 1052022770

View in Genome Browser
Species Human (GRCh38)
Location 9:23543753-23543775
Sequence CCTTATTTGGGGACATTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052022765_1052022770 -10 Left 1052022765 9:23543740-23543762 CCGAGAGACAGAACCTTATTTGG No data
Right 1052022770 9:23543753-23543775 CCTTATTTGGGGACATTGTAAGG No data
1052022762_1052022770 23 Left 1052022762 9:23543707-23543729 CCTTTTAAAAACTAGTCAGAAAC No data
Right 1052022770 9:23543753-23543775 CCTTATTTGGGGACATTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052022770 Original CRISPR CCTTATTTGGGGACATTGTA AGG Intergenic
No off target data available for this crispr