ID: 1052023856

View in Genome Browser
Species Human (GRCh38)
Location 9:23553973-23553995
Sequence GAATTTTAACAGCCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052023855_1052023856 16 Left 1052023855 9:23553934-23553956 CCACTGCAGATCTACTGAATTTG No data
Right 1052023856 9:23553973-23553995 GAATTTTAACAGCCTACTCCTGG No data
1052023854_1052023856 17 Left 1052023854 9:23553933-23553955 CCCACTGCAGATCTACTGAATTT No data
Right 1052023856 9:23553973-23553995 GAATTTTAACAGCCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052023856 Original CRISPR GAATTTTAACAGCCTACTCC TGG Intergenic
No off target data available for this crispr