ID: 1052025770

View in Genome Browser
Species Human (GRCh38)
Location 9:23571685-23571707
Sequence TTTGTCTCCTGACCAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052025770_1052025773 -7 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025773 9:23571701-23571723 AGACAAAATATAATAGCCAGGGG No data
1052025770_1052025776 20 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025776 9:23571728-23571750 TCTAGACCAGAGCCTTTGTTGGG No data
1052025770_1052025771 -9 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025771 9:23571699-23571721 GGAGACAAAATATAATAGCCAGG No data
1052025770_1052025778 22 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025778 9:23571730-23571752 TAGACCAGAGCCTTTGTTGGGGG No data
1052025770_1052025775 19 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025775 9:23571727-23571749 GTCTAGACCAGAGCCTTTGTTGG No data
1052025770_1052025772 -8 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025772 9:23571700-23571722 GAGACAAAATATAATAGCCAGGG No data
1052025770_1052025777 21 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025777 9:23571729-23571751 CTAGACCAGAGCCTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052025770 Original CRISPR TTTGTCTCCTGACCAAAACC TGG (reversed) Intergenic
No off target data available for this crispr