ID: 1052025772

View in Genome Browser
Species Human (GRCh38)
Location 9:23571700-23571722
Sequence GAGACAAAATATAATAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052025770_1052025772 -8 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025772 9:23571700-23571722 GAGACAAAATATAATAGCCAGGG No data
1052025766_1052025772 17 Left 1052025766 9:23571660-23571682 CCTATGTAGGGTCACAGGGGAAG No data
Right 1052025772 9:23571700-23571722 GAGACAAAATATAATAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052025772 Original CRISPR GAGACAAAATATAATAGCCA GGG Intergenic
No off target data available for this crispr