ID: 1052025775

View in Genome Browser
Species Human (GRCh38)
Location 9:23571727-23571749
Sequence GTCTAGACCAGAGCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052025770_1052025775 19 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025775 9:23571727-23571749 GTCTAGACCAGAGCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052025775 Original CRISPR GTCTAGACCAGAGCCTTTGT TGG Intergenic
No off target data available for this crispr