ID: 1052025777

View in Genome Browser
Species Human (GRCh38)
Location 9:23571729-23571751
Sequence CTAGACCAGAGCCTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052025770_1052025777 21 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025777 9:23571729-23571751 CTAGACCAGAGCCTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052025777 Original CRISPR CTAGACCAGAGCCTTTGTTG GGG Intergenic
No off target data available for this crispr