ID: 1052025778

View in Genome Browser
Species Human (GRCh38)
Location 9:23571730-23571752
Sequence TAGACCAGAGCCTTTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052025774_1052025778 -10 Left 1052025774 9:23571717-23571739 CCAGGGGAAAGTCTAGACCAGAG No data
Right 1052025778 9:23571730-23571752 TAGACCAGAGCCTTTGTTGGGGG No data
1052025770_1052025778 22 Left 1052025770 9:23571685-23571707 CCAGGTTTTGGTCAGGAGACAAA No data
Right 1052025778 9:23571730-23571752 TAGACCAGAGCCTTTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052025778 Original CRISPR TAGACCAGAGCCTTTGTTGG GGG Intergenic
No off target data available for this crispr