ID: 1052026415

View in Genome Browser
Species Human (GRCh38)
Location 9:23577891-23577913
Sequence GGGGTTATAAAGATTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052026414_1052026415 -6 Left 1052026414 9:23577874-23577896 CCAATGAGCTCTATTGAGGGGTT No data
Right 1052026415 9:23577891-23577913 GGGGTTATAAAGATTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052026415 Original CRISPR GGGGTTATAAAGATTGAACA TGG Intergenic
No off target data available for this crispr