ID: 1052027313

View in Genome Browser
Species Human (GRCh38)
Location 9:23588041-23588063
Sequence ATAGACTTAAAAGTAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052027313_1052027318 15 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG No data
1052027313_1052027319 18 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027319 9:23588082-23588104 CTGCATGGAGCACCCTCTGGTGG No data
1052027313_1052027324 26 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027324 9:23588090-23588112 AGCACCCTCTGGTGGGCAGGGGG No data
1052027313_1052027320 19 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027320 9:23588083-23588105 TGCATGGAGCACCCTCTGGTGGG No data
1052027313_1052027321 23 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027321 9:23588087-23588109 TGGAGCACCCTCTGGTGGGCAGG No data
1052027313_1052027322 24 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027322 9:23588088-23588110 GGAGCACCCTCTGGTGGGCAGGG No data
1052027313_1052027323 25 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027323 9:23588089-23588111 GAGCACCCTCTGGTGGGCAGGGG No data
1052027313_1052027316 3 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027316 9:23588067-23588089 CATGGTTTACTGCCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052027313 Original CRISPR ATAGACTTAAAAGTAGCCTG TGG (reversed) Intergenic
No off target data available for this crispr