ID: 1052027318

View in Genome Browser
Species Human (GRCh38)
Location 9:23588079-23588101
Sequence CCTCTGCATGGAGCACCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052027313_1052027318 15 Left 1052027313 9:23588041-23588063 CCACAGGCTACTTTTAAGTCTAT No data
Right 1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG No data
1052027315_1052027318 -10 Left 1052027315 9:23588066-23588088 CCATGGTTTACTGCCTCTGCATG No data
Right 1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052027318 Original CRISPR CCTCTGCATGGAGCACCCTC TGG Intergenic
No off target data available for this crispr