ID: 1052028140

View in Genome Browser
Species Human (GRCh38)
Location 9:23597467-23597489
Sequence GCCACCAGTGGGCTGTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052028140_1052028144 5 Left 1052028140 9:23597467-23597489 CCAAAAGACAGCCCACTGGTGGC No data
Right 1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG No data
1052028140_1052028143 -8 Left 1052028140 9:23597467-23597489 CCAAAAGACAGCCCACTGGTGGC No data
Right 1052028143 9:23597482-23597504 CTGGTGGCAGTAGCAGCTTCTGG No data
1052028140_1052028145 6 Left 1052028140 9:23597467-23597489 CCAAAAGACAGCCCACTGGTGGC No data
Right 1052028145 9:23597496-23597518 AGCTTCTGGATTCTGTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052028140 Original CRISPR GCCACCAGTGGGCTGTCTTT TGG (reversed) Intergenic
No off target data available for this crispr