ID: 1052028144

View in Genome Browser
Species Human (GRCh38)
Location 9:23597495-23597517
Sequence CAGCTTCTGGATTCTGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052028142_1052028144 -7 Left 1052028142 9:23597479-23597501 CCACTGGTGGCAGTAGCAGCTTC No data
Right 1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG No data
1052028141_1052028144 -6 Left 1052028141 9:23597478-23597500 CCCACTGGTGGCAGTAGCAGCTT No data
Right 1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG No data
1052028138_1052028144 6 Left 1052028138 9:23597466-23597488 CCCAAAAGACAGCCCACTGGTGG No data
Right 1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG No data
1052028140_1052028144 5 Left 1052028140 9:23597467-23597489 CCAAAAGACAGCCCACTGGTGGC No data
Right 1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052028144 Original CRISPR CAGCTTCTGGATTCTGTCAG TGG Intergenic
No off target data available for this crispr