ID: 1052028207

View in Genome Browser
Species Human (GRCh38)
Location 9:23598476-23598498
Sequence TTCAAAAAGATGTCAGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052028201_1052028207 26 Left 1052028201 9:23598427-23598449 CCCTGCTCGACCAAGGTTTAATT No data
Right 1052028207 9:23598476-23598498 TTCAAAAAGATGTCAGGACATGG No data
1052028202_1052028207 25 Left 1052028202 9:23598428-23598450 CCTGCTCGACCAAGGTTTAATTC No data
Right 1052028207 9:23598476-23598498 TTCAAAAAGATGTCAGGACATGG No data
1052028205_1052028207 16 Left 1052028205 9:23598437-23598459 CCAAGGTTTAATTCAAGGGAAAC No data
Right 1052028207 9:23598476-23598498 TTCAAAAAGATGTCAGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052028207 Original CRISPR TTCAAAAAGATGTCAGGACA TGG Intergenic
No off target data available for this crispr