ID: 1052029078

View in Genome Browser
Species Human (GRCh38)
Location 9:23608282-23608304
Sequence TCACTTCTGTCTACAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052029078_1052029080 -8 Left 1052029078 9:23608282-23608304 CCATCATCTGTAGACAGAAGTGA No data
Right 1052029080 9:23608297-23608319 AGAAGTGAGGACAGCACAGTTGG No data
1052029078_1052029081 -1 Left 1052029078 9:23608282-23608304 CCATCATCTGTAGACAGAAGTGA No data
Right 1052029081 9:23608304-23608326 AGGACAGCACAGTTGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052029078 Original CRISPR TCACTTCTGTCTACAGATGA TGG (reversed) Intergenic
No off target data available for this crispr