ID: 1052033238

View in Genome Browser
Species Human (GRCh38)
Location 9:23651743-23651765
Sequence CTTAACTACCACATCCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052033238_1052033241 0 Left 1052033238 9:23651743-23651765 CCTTAAGGGATGTGGTAGTTAAG No data
Right 1052033241 9:23651766-23651788 GAAGGCAAAGAACCAGTAATAGG No data
1052033238_1052033243 24 Left 1052033238 9:23651743-23651765 CCTTAAGGGATGTGGTAGTTAAG No data
Right 1052033243 9:23651790-23651812 AGATTAAGTTTACAAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052033238 Original CRISPR CTTAACTACCACATCCCTTA AGG (reversed) Intergenic
No off target data available for this crispr