ID: 1052033241

View in Genome Browser
Species Human (GRCh38)
Location 9:23651766-23651788
Sequence GAAGGCAAAGAACCAGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052033232_1052033241 23 Left 1052033232 9:23651720-23651742 CCAGGTAGAGAATACACTTTTCC No data
Right 1052033241 9:23651766-23651788 GAAGGCAAAGAACCAGTAATAGG No data
1052033237_1052033241 1 Left 1052033237 9:23651742-23651764 CCCTTAAGGGATGTGGTAGTTAA No data
Right 1052033241 9:23651766-23651788 GAAGGCAAAGAACCAGTAATAGG No data
1052033231_1052033241 30 Left 1052033231 9:23651713-23651735 CCACGTACCAGGTAGAGAATACA No data
Right 1052033241 9:23651766-23651788 GAAGGCAAAGAACCAGTAATAGG No data
1052033238_1052033241 0 Left 1052033238 9:23651743-23651765 CCTTAAGGGATGTGGTAGTTAAG No data
Right 1052033241 9:23651766-23651788 GAAGGCAAAGAACCAGTAATAGG No data
1052033236_1052033241 2 Left 1052033236 9:23651741-23651763 CCCCTTAAGGGATGTGGTAGTTA No data
Right 1052033241 9:23651766-23651788 GAAGGCAAAGAACCAGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052033241 Original CRISPR GAAGGCAAAGAACCAGTAAT AGG Intergenic
No off target data available for this crispr