ID: 1052033243

View in Genome Browser
Species Human (GRCh38)
Location 9:23651790-23651812
Sequence AGATTAAGTTTACAAGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052033236_1052033243 26 Left 1052033236 9:23651741-23651763 CCCCTTAAGGGATGTGGTAGTTA No data
Right 1052033243 9:23651790-23651812 AGATTAAGTTTACAAGTTACTGG No data
1052033237_1052033243 25 Left 1052033237 9:23651742-23651764 CCCTTAAGGGATGTGGTAGTTAA No data
Right 1052033243 9:23651790-23651812 AGATTAAGTTTACAAGTTACTGG No data
1052033238_1052033243 24 Left 1052033238 9:23651743-23651765 CCTTAAGGGATGTGGTAGTTAAG No data
Right 1052033243 9:23651790-23651812 AGATTAAGTTTACAAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052033243 Original CRISPR AGATTAAGTTTACAAGTTAC TGG Intergenic
No off target data available for this crispr