ID: 1052037464

View in Genome Browser
Species Human (GRCh38)
Location 9:23699010-23699032
Sequence TGTCAGTTGTAAGGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052037464_1052037469 23 Left 1052037464 9:23699010-23699032 CCAAGTTTCCCTTACAACTGACA 0: 1
1: 0
2: 3
3: 15
4: 175
Right 1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG No data
1052037464_1052037467 15 Left 1052037464 9:23699010-23699032 CCAAGTTTCCCTTACAACTGACA 0: 1
1: 0
2: 3
3: 15
4: 175
Right 1052037467 9:23699048-23699070 CTTCCAAAATGTCTTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052037464 Original CRISPR TGTCAGTTGTAAGGGAAACT TGG (reversed) Intronic
901147669 1:7077573-7077595 TGTCAGCTGTGAGGGAAGATAGG + Intronic
901731795 1:11285387-11285409 GGACAGTAGGAAGGGAAACTTGG + Intronic
904775430 1:32902999-32903021 TGTCAGGTGGAAGGGAAGATGGG + Intergenic
905357626 1:37395721-37395743 GCTCAGTTGTAAGGGGAACTTGG - Intergenic
907602077 1:55782053-55782075 GCTCAGTTGCAATGGAAACTTGG + Intergenic
908401813 1:63778503-63778525 TGCCTGGTGGAAGGGAAACTGGG - Intronic
909247787 1:73310640-73310662 TGTCAGTAGTAGGAGAAACTGGG + Intergenic
910353310 1:86324713-86324735 TTTTATTTGTAAGGCAAACTGGG + Intergenic
911602823 1:99865615-99865637 TAACATTTGTAAGGTAAACTGGG - Intronic
911767000 1:101689406-101689428 TTTCAGTTGGAAGAGAAAGTAGG - Intergenic
913667902 1:121067006-121067028 TGTCAGTTGTAGAGGAAACTAGG - Intergenic
914019593 1:143854136-143854158 TGTCAGTTGTAGAGGAAACTAGG - Intergenic
914323934 1:146592570-146592592 TGTGAGATCTAAAGGAAACTAGG + Intergenic
914658144 1:149762353-149762375 TGTCAGTTGTAGAGGAAACTAGG - Intergenic
914983984 1:152440956-152440978 TGGCAGCTGTAAGGGTAGCTGGG + Intergenic
916478092 1:165188956-165188978 TGTTAATAGTAAAGGAAACTGGG - Intergenic
918648354 1:186928246-186928268 TGTAAGCTGTGAGGGAAACAGGG + Intronic
919776680 1:201198809-201198831 TGCTAGTTGCAAGGGAAGCTGGG + Intronic
920149579 1:203893758-203893780 TGTGAGTTTTGAGAGAAACTGGG + Intergenic
921819638 1:219602301-219602323 TGGCACTTGTAAGATAAACTTGG - Intergenic
922407908 1:225337514-225337536 TATCAGCTGCAAGGGAAATTAGG - Intronic
924484896 1:244472551-244472573 TGTCAGTAATAGGGCAAACTGGG - Intronic
1064067286 10:12193227-12193249 AGACAGTTTTAAGGGAGACTGGG + Intronic
1064502028 10:15984042-15984064 TGCCAGGTGTAAGGCACACTAGG + Intergenic
1069334351 10:67330115-67330137 TTACAGCTGCAAGGGAAACTGGG + Intronic
1069951501 10:72021705-72021727 TGTCAGTTCTATGGGATAATTGG + Intergenic
1070943136 10:80364661-80364683 AGGCAGTTGTAAGGGAAGATGGG + Intronic
1072017985 10:91368962-91368984 TGTGAATGGTAAGGGAAACAAGG - Intergenic
1075475811 10:122732490-122732512 TGTAACTTGTAAGTAAAACTGGG - Intergenic
1076127550 10:127987323-127987345 TCTCAGCTGTCAGGGAAACATGG + Intronic
1078495821 11:11815316-11815338 AGTCAGATGTCAGGCAAACTGGG + Intergenic
1078962213 11:16290040-16290062 TGGCAGTTGAAATGGAAACATGG - Intronic
1079281507 11:19090943-19090965 TGTAAGGTGTAAGGGAAAACGGG - Intergenic
1080843773 11:36008179-36008201 TGTCATTTGTAAAGAACACTTGG + Intronic
1082613100 11:55326412-55326434 TGTAAGTTTTAAGGGAGATTAGG - Intergenic
1084056781 11:66639012-66639034 TGTCAGATATAAGGGAAAGGGGG - Exonic
1085747800 11:79129616-79129638 TGCAAGTTGTCAGGGAAGCTGGG - Intronic
1086540243 11:87900553-87900575 TGTCAGTTGGGAGGTAAACTTGG - Intergenic
1089139515 11:116274705-116274727 TGTCAGTTACTAAGGAAACTAGG + Intergenic
1089776680 11:120842413-120842435 ACTCACTTGTAAGGGAAGCTGGG + Intronic
1090080595 11:123609715-123609737 GGTCACTTGGAGGGGAAACTTGG + Intronic
1090192961 11:124788637-124788659 AGTCAGTTTTAAGGAAAACCAGG - Intronic
1095321804 12:40837653-40837675 TCTGAGGTGTTAGGGAAACTTGG + Intronic
1098329111 12:69334061-69334083 TGTTAGTAATAAGGGAAAGTGGG - Intergenic
1098638745 12:72815442-72815464 TGCCATCTGTAGGGGAAACTTGG + Intergenic
1099374705 12:81885011-81885033 TGTTACTTATAAGGGAAGCTGGG + Intergenic
1101694745 12:107114417-107114439 TGTTAATAATAAGGGAAACTGGG + Intergenic
1102216718 12:111166879-111166901 TCTCTGTTGGAAGGGAATCTTGG + Intronic
1102878041 12:116463016-116463038 TGTTAATTATAGGGGAAACTGGG + Intergenic
1109122696 13:58478039-58478061 TGGCAGCTATAAGGGAATCTGGG + Intergenic
1110441895 13:75535549-75535571 TGTCAGGTGTGAGGGAGAGTTGG + Intronic
1113125104 13:106969291-106969313 TGTCAGTTGTAACTGCTACTGGG + Intergenic
1113832737 13:113309430-113309452 TTTCAGGTGTAAGAGAAAGTTGG - Intronic
1117790316 14:59333295-59333317 TGTAAGTAGAAAGGCAAACTTGG + Intronic
1118161841 14:63298726-63298748 TTTCAGTTGAAAGGTAATCTTGG - Intergenic
1118694107 14:68367375-68367397 TGTGAGTTGTAAGGGACCATTGG + Intronic
1118823149 14:69358135-69358157 CCTCAGTTGGATGGGAAACTAGG + Intergenic
1119396736 14:74331888-74331910 TGTCACTTCTAAGGGACACTTGG + Intronic
1120851584 14:89176900-89176922 CCTCAGTTTTAAGGGAAATTAGG - Intronic
1120925655 14:89794848-89794870 TGTTAATAGTAGGGGAAACTGGG - Exonic
1126212015 15:46110706-46110728 TATTAGTAGTAAGGGAAACTGGG - Intergenic
1126993837 15:54416605-54416627 TGTCTGATGTAAGAGAATCTTGG - Intronic
1129902616 15:79163083-79163105 TGTGAGGTGTAAGAGAAACAGGG - Intergenic
1130436776 15:83907964-83907986 TGTCAGTAGGAAGGTAAATTAGG - Intronic
1131421060 15:92305787-92305809 TGTGAGTACTAAGGGAAGCTGGG - Intergenic
1133382479 16:5342808-5342830 TGTCCATAGTAAGGAAAACTAGG - Intergenic
1135023456 16:18981584-18981606 TGTTAATAGTAGGGGAAACTGGG - Intergenic
1137702507 16:50507096-50507118 TGTCCTCTGAAAGGGAAACTGGG - Intergenic
1138319585 16:56100591-56100613 TATTAGTTATAGGGGAAACTGGG + Intergenic
1138588933 16:57988929-57988951 TGTCATTTGGAGGGGACACTGGG - Intergenic
1140009628 16:71118274-71118296 TGTGAGATCTAAAGGAAACTAGG - Intronic
1144725988 17:17503040-17503062 TGCCTGTTGCAAGGGACACTCGG + Intergenic
1148441705 17:47714920-47714942 TGTCAGTGGTAATGCAAATTAGG - Intergenic
1158109692 18:53927618-53927640 TGTCACTTGTTAGGCAAACAAGG + Intergenic
1158765399 18:60445121-60445143 AGTCTGTTTTATGGGAAACTAGG + Intergenic
1162243826 19:9382214-9382236 TCACAGCTGTAAGGGAAGCTGGG - Exonic
1165583204 19:36887424-36887446 TTTTAGTAGTAGGGGAAACTAGG + Intronic
926789466 2:16555730-16555752 TGTCATTTATCAGAGAAACTTGG + Intronic
928197182 2:29224371-29224393 TGGCAGTGGTTAGGGAAACAGGG - Intronic
929275307 2:40018857-40018879 TGTAAGTAGTAAGGCAAACTTGG + Intergenic
931685383 2:64787859-64787881 TCTCAGTTATAAGGGAAGCTGGG - Intergenic
931810578 2:65850758-65850780 CTGCAGTTGTAAGGGAAACAAGG - Intergenic
933360790 2:81281519-81281541 TGTCAGTTTTAAAAAAAACTTGG - Intergenic
935969774 2:108519508-108519530 TGTTAATAATAAGGGAAACTGGG + Intergenic
936919331 2:117671430-117671452 TATCAGTTCTATGGGACACTTGG + Intergenic
939370501 2:141292962-141292984 TGTCAATAGTAGGGGAAAGTGGG + Intronic
940243064 2:151584231-151584253 TTGCACTTGTCAGGGAAACTTGG - Intronic
940244019 2:151594783-151594805 TTGCACTTGTCAGGGAAACTTGG - Intronic
940459847 2:153951101-153951123 TGTCATGTGTACGGGAAATTGGG + Intronic
942270334 2:174268029-174268051 TGTAAGTAGAAAGGGAAAATAGG - Intergenic
945157616 2:206856124-206856146 TGTCAGATGGAAGGGAAAATTGG - Intergenic
945589280 2:211709582-211709604 TTTCAGTTGTAACAGAGACTGGG + Intronic
947309522 2:228785430-228785452 GCTCATATGTAAGGGAAACTTGG + Intergenic
1170552091 20:17486946-17486968 TCTCAGTTCTAAGAGAAACATGG - Intergenic
1172102638 20:32494667-32494689 TCCCAGTTGTAAGGGAGGCTGGG - Intronic
1178560482 21:33634849-33634871 TGTTTGTTTTAAGGGATACTAGG - Intronic
1181838331 22:25629577-25629599 TGTAAGTCGTAAGGGACACCTGG + Intronic
949679414 3:6495513-6495535 TATCAGGTGTAAGGGACACCAGG - Intergenic
950174725 3:10864983-10865005 TCTCAGCTGTGAGGGACACTGGG - Intronic
951269599 3:20608248-20608270 TGTAGGTTGTCAGGGAAACGGGG - Intergenic
951325026 3:21291486-21291508 TGTTAGTTATAGAGGAAACTGGG + Intergenic
952867807 3:37866969-37866991 TGTCAGTAATAAGAGAAACCGGG - Intronic
953221708 3:40977717-40977739 ACTCAGTTGTAAGGAAATCTGGG + Intergenic
954794430 3:53154362-53154384 TGTCAGTGGTAGGGGATACTTGG - Intergenic
955016322 3:55073608-55073630 TATCAGTGGTAAGGAAACCTGGG + Intronic
955598688 3:60620867-60620889 TGTTAATTATAAAGGAAACTGGG + Intronic
958649173 3:96915134-96915156 TGTCATTTTAAAGGGAAACATGG + Intronic
960474636 3:118108834-118108856 TGTGAGTAATAAGTGAAACTAGG + Intergenic
963038856 3:141054018-141054040 TTTCAGTTGTATGAAAAACTAGG - Intronic
964389728 3:156184755-156184777 GGTCAGTTCTAAGCAAAACTGGG + Intronic
965105744 3:164350034-164350056 AGTCAGCTGTGAGGGAAAATAGG - Intergenic
967507105 3:190264787-190264809 TGTAAGTTTTAAGGGGCACTAGG + Intergenic
969859045 4:10021369-10021391 TGTCATCTGTGAGGGGAACTAGG + Exonic
970327960 4:14947726-14947748 TGTCATTTGTAGGTGAAAGTGGG + Intergenic
972019477 4:34292899-34292921 TGTCAGCTGAAATGGGAACTTGG - Intergenic
972975081 4:44624370-44624392 TGTCAGTTTTAAAGATAACTTGG + Intronic
973110062 4:46388286-46388308 TGTCAGCTCGAAGGAAAACTTGG + Intronic
974461748 4:62197477-62197499 TTTCAGTTATAAGAGAAGCTGGG - Intergenic
981205090 4:142031632-142031654 TGTCAATTGTATGAGTAACTTGG + Intronic
982145783 4:152389523-152389545 TTTCACTTGTAAGTGAAACGTGG - Intronic
982699210 4:158640397-158640419 TGTAAGTTGTAAGAGAAGCATGG + Intronic
983066941 4:163221986-163222008 TGTCAGTTTTATGGAAAAATTGG - Intergenic
984270901 4:177547702-177547724 TATCAGTTCTATGGGAAAATTGG + Intergenic
985382170 4:189406110-189406132 TGTTAGTAATAAGGGAAACTAGG - Intergenic
987654282 5:20785287-20785309 TCTCAGTTATATGGAAAACTTGG - Intergenic
988150996 5:27379614-27379636 TGTCAGATGTCAGTGAAATTAGG + Intergenic
988921165 5:35944044-35944066 TGTTAGTTGCAAGAGAGACTAGG + Intergenic
990673443 5:58158310-58158332 TGTCAGTAATAGGGGAAGCTGGG - Intergenic
990833279 5:59985049-59985071 TGACAGCTGTAAAGGAATCTGGG + Intronic
991076841 5:62549522-62549544 TGGAAGTCATAAGGGAAACTTGG + Intronic
991220186 5:64205239-64205261 TTTGAATTGTAAGGGAAACTGGG + Intronic
992006425 5:72482911-72482933 TGTTAATTTTAAGGGAAATTTGG - Intronic
994297786 5:98112020-98112042 TGTGAGTGGAAAGGGAAACAGGG + Intergenic
994682898 5:102911561-102911583 TGTCCTTTGTAAAGTAAACTGGG - Intronic
994781053 5:104090149-104090171 TTTCAGTTCTATGGGAAAATTGG + Intergenic
995004197 5:107171209-107171231 TGTCAGTTCTATTGGACACTTGG + Intergenic
995209728 5:109523565-109523587 TGCCAGGTGTAATGAAAACTGGG - Intergenic
995807624 5:116071175-116071197 TGTCAGTAATACGGGAAATTGGG - Intergenic
996642998 5:125779989-125780011 TGTCAGAGGGGAGGGAAACTAGG - Intergenic
998926379 5:147130658-147130680 TCTGAGGTGTTAGGGAAACTTGG - Intergenic
999119360 5:149197368-149197390 TGTCAGTTGCAAGGGATCATGGG - Intronic
1002764892 6:230912-230934 TGGCAGTTGCAAGAGGAACTCGG + Intergenic
1007049506 6:38812589-38812611 TGTTAGTTGGAAAGGAAAATCGG - Intronic
1008241880 6:49123603-49123625 TCTTATTTGGAAGGGAAACTAGG + Intergenic
1008424168 6:51337530-51337552 TCCTAGCTGTAAGGGAAACTGGG + Intergenic
1009566004 6:65312290-65312312 TGGCACTTGTAAGATAAACTTGG + Intronic
1010398100 6:75415305-75415327 TGTCAATTATAGAGGAAACTGGG + Intronic
1011724071 6:90190517-90190539 TGTGACATGTAAGGGAAACTTGG - Intronic
1014515776 6:122376777-122376799 TGGCAGGTGGAAGGGAAAGTTGG + Intergenic
1015386819 6:132634113-132634135 TGTCAGTTATTTGAGAAACTGGG - Intergenic
1016580090 6:145619587-145619609 TCTCAGTAGTAATGGAATCTAGG + Intronic
1018003747 6:159601892-159601914 TGGCAGATGTAAGGGCAACGTGG + Intergenic
1018249389 6:161853005-161853027 TGTCAGTTTTAAGAGACACTGGG + Intronic
1018587733 6:165381342-165381364 TTTCAGTATTAAAGGAAACTAGG + Intronic
1021343959 7:19499437-19499459 TGACAGTTGTGAAGGAAACCAGG + Intergenic
1022036617 7:26540671-26540693 TATCAGTTCAAAGGGAAACTTGG + Intergenic
1022228987 7:28394679-28394701 TGTCAAATGTAGGGGAAATTTGG - Intronic
1025962032 7:66231412-66231434 TGGCACTTGTCAGGGAAGCTGGG + Intronic
1030757057 7:113299700-113299722 TGTTAGTAATATGGGAAACTGGG - Intergenic
1030870500 7:114749704-114749726 TGTGAATTGTGAGGGAAAATGGG + Intergenic
1031100011 7:117468226-117468248 TGTTAATAGTAAGAGAAACTGGG - Intronic
1034679378 7:152916891-152916913 TATTAGTAATAAGGGAAACTAGG - Intergenic
1036956129 8:13190353-13190375 TGACAGTGGAAAGGGAAACAGGG - Intronic
1038511755 8:28144028-28144050 AATCAGTTACAAGGGAAACTAGG - Intronic
1039471404 8:37815625-37815647 TGTGAGTTGTTAGGGAAATGGGG + Intronic
1041079011 8:54197415-54197437 TGTCAGTTCTAAGGGATTTTTGG + Intergenic
1041816781 8:61982073-61982095 TCTCAGTTCTATGGGAAAATTGG - Intergenic
1041828687 8:62127547-62127569 TGTCAGTAGTAGAAGAAACTGGG + Intergenic
1043049584 8:75368446-75368468 TGTAAATTGTAAAGGAATCTGGG + Intergenic
1043176765 8:77030957-77030979 TCTTAGTTGTAAGGGTATCTGGG + Intergenic
1043420691 8:80095571-80095593 TGTTAATAATAAGGGAAACTAGG + Intronic
1044232877 8:89799273-89799295 TGTCAATAGTAGGGGGAACTGGG - Intergenic
1045501013 8:102744340-102744362 ACTCAGTTGCAAGGGAAGCTGGG - Intergenic
1046591193 8:116209245-116209267 AGCCAGCTGTAAGGGAGACTGGG - Intergenic
1047585714 8:126269810-126269832 TGTTAGTAATAAGGGAAACTGGG + Intergenic
1047621796 8:126615335-126615357 TGTCAATATTAGGGGAAACTGGG - Intergenic
1049215007 8:141403508-141403530 TGCCAGTTTTAAGTGAAAATTGG + Intronic
1050971330 9:11879663-11879685 TGTTAATTGTAGAGGAAACTGGG + Intergenic
1051105030 9:13569548-13569570 TGTCATTTGGAAGTAAAACTGGG - Intergenic
1051798259 9:20900753-20900775 TGTGAGTTGTTATGGTAACTGGG + Intronic
1052002753 9:23306799-23306821 TGTCAGTTGCATGTGAAAATAGG - Intergenic
1052037464 9:23699010-23699032 TGTCAGTTGTAAGGGAAACTTGG - Intronic
1061426558 9:130502069-130502091 TATCAGGTGTCAGGGAAACCAGG - Intergenic
1186996580 X:15130079-15130101 AGTCAGTTGAAAGGGGAACAAGG + Intergenic
1189133293 X:38522721-38522743 TGTTACTATTAAGGGAAACTAGG - Intronic
1189942971 X:46145895-46145917 TGTCACTATTGAGGGAAACTGGG - Intergenic
1190363402 X:49669630-49669652 CTTCAGTTTTATGGGAAACTTGG + Intergenic
1193039085 X:76985739-76985761 TGTTAATAATAAGGGAAACTGGG - Intergenic
1197158047 X:123291748-123291770 TATCAGTTGCAAGGGAGCCTGGG + Intronic
1197330186 X:125144596-125144618 TGTTAGTTGTTTTGGAAACTTGG - Intergenic
1198611210 X:138402724-138402746 TGTCAGTTGTAAGGATAAAAGGG - Intergenic
1199733564 X:150662054-150662076 TGTCAGTTGTAAATAATACTGGG + Intronic
1200031754 X:153302791-153302813 TTTCAGTTGGAGGGGAATCTTGG - Intergenic
1201665558 Y:16449575-16449597 TGTCTGTAGTTTGGGAAACTAGG - Intergenic