ID: 1052037465

View in Genome Browser
Species Human (GRCh38)
Location 9:23699018-23699040
Sequence TAAGAGATTGTCAGTTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052037465_1052037467 7 Left 1052037465 9:23699018-23699040 CCCTTACAACTGACAATCTCTTA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1052037467 9:23699048-23699070 CTTCCAAAATGTCTTTCTATAGG No data
1052037465_1052037469 15 Left 1052037465 9:23699018-23699040 CCCTTACAACTGACAATCTCTTA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052037465 Original CRISPR TAAGAGATTGTCAGTTGTAA GGG (reversed) Intronic
901900228 1:12354858-12354880 CAAGTAATTTTCAGTTGTAAGGG + Intronic
902068535 1:13711420-13711442 TCAGAGGTTCTCAGTTGGAAGGG + Intronic
903100017 1:21021404-21021426 TGAGAAATTGTGAGTTGTTATGG - Intronic
906181305 1:43822045-43822067 GAAGAGATTGCAAGTTGCAATGG + Intronic
907041022 1:51259564-51259586 TAAGAGATTTACAGTGATAATGG - Intronic
908868151 1:68576026-68576048 TAGGAGATTGTGAGGGGTAAGGG - Intergenic
910404945 1:86878300-86878322 TAATACATTGTCAGTTTTTAAGG - Intronic
910806992 1:91198387-91198409 GAAGAGACAATCAGTTGTAAGGG + Intergenic
911695360 1:100884660-100884682 TAAGAGTTTGTCAGATAGAAGGG - Intronic
912724886 1:112050294-112050316 TAAGAGATTAGCAGGTGTGAGGG - Intergenic
912754212 1:112310826-112310848 TAAGAAACTCTCAGTTGTCAGGG - Intergenic
913300216 1:117362362-117362384 TAAGACATACTCACTTGTAATGG + Intergenic
913315058 1:117542787-117542809 AAATAGAATGTCAATTGTAATGG + Intergenic
915008102 1:152659265-152659287 TAAGAGGGTATCAGTTGTAAGGG + Intergenic
915009380 1:152671124-152671146 AAAGAGGCTATCAGTTGTAAGGG + Intergenic
915010636 1:152682852-152682874 TAAGAGGCTATCAATTGTAAGGG + Intergenic
917343458 1:174004503-174004525 TAAGAGAATGTCACTTGGCAGGG + Intronic
917347613 1:174044399-174044421 CAAGAGATTTTCAGGTGTATAGG - Intergenic
918020942 1:180689109-180689131 TAAGAAATTGACATTTCTAATGG + Intronic
919626813 1:199919304-199919326 TAATAGACTGTCTGTTGTAGTGG + Intergenic
920939762 1:210470661-210470683 CAAGAGCTTGTCAATAGTAAAGG - Intronic
923353961 1:233135456-233135478 AAAGAAAATGTCTGTTGTAATGG - Intronic
924242392 1:242053822-242053844 TAAGAAATCTACAGTTGTAAAGG + Intergenic
1063506264 10:6602849-6602871 TAAGACATTGTTAGCTGTACTGG - Intergenic
1070016225 10:72534890-72534912 TAAGAGAGTGTAAGTCATAAAGG + Intronic
1070214882 10:74367342-74367364 TCATGGATTGTCAGTTGGAATGG + Intronic
1072317930 10:94221849-94221871 AAAGAGATGATCATTTGTAATGG - Intronic
1072852439 10:98910182-98910204 AAAGAGACTGACAGTTGTGAGGG + Intronic
1073879314 10:107961187-107961209 AAAGAAATTGTCAGGTGCAAGGG - Intergenic
1075643012 10:124078666-124078688 TAACTGATTGTCAATTGGAAGGG + Intronic
1076146108 10:128124275-128124297 AAACAAATTCTCAGTTGTAAGGG - Intronic
1078358640 11:10651692-10651714 TAAGAGGTTCTCAGTGCTAATGG + Intronic
1080113339 11:28594352-28594374 GAAGAGATTGCCCGTTGTACTGG + Intergenic
1080207248 11:29744356-29744378 CAAGTGATTTTCAGTTGTTATGG + Intergenic
1081003260 11:37701377-37701399 TAAGCAAATGTCAGTTTTAAAGG + Intergenic
1081116348 11:39206180-39206202 AAAGAGATGGGCAGTGGTAAAGG + Intergenic
1085835328 11:79950041-79950063 TAAGAGTTTTGCAGTTGAAATGG + Intergenic
1087228671 11:95632482-95632504 GAAGAGCTTCTCAGTTGTAAGGG + Intergenic
1090591401 11:128274014-128274036 TGAGTGATTGTCAATTGTCATGG - Intergenic
1099957545 12:89365640-89365662 CAAGAAAGTGTCAGTTATAAAGG + Intergenic
1100109898 12:91227731-91227753 AAAGAGGTTGTCAGTGGTGAAGG - Intergenic
1104299419 12:127550711-127550733 GAAGATATTGTGTGTTGTAAGGG + Intergenic
1106091988 13:26604302-26604324 TAATAAATTGCCAGTTGCAATGG + Intronic
1106871038 13:34021034-34021056 TAAGAGATTAGCAGTGGTAAGGG - Intergenic
1108644624 13:52414580-52414602 TAAGACATTGTCAGTGGGTAAGG - Exonic
1109074350 13:57815351-57815373 GAACTGATTGTCAGTGGTAAGGG + Intergenic
1111657121 13:91167694-91167716 TAAGAGTTTCTTAATTGTAAAGG - Intergenic
1115287961 14:31738283-31738305 TAAGAGGTTGCCAGTTATATGGG + Intronic
1119834920 14:77740494-77740516 TGAGAGAGTGAGAGTTGTAAGGG - Intronic
1127883699 15:63180133-63180155 TAAGAAATTGACAGATGAAAGGG - Intergenic
1129938788 15:79475837-79475859 CAAGACATTGTCAGTTGTTCTGG - Intergenic
1132401331 15:101507802-101507824 TAAGAGATTGCAAGTTGGAAAGG - Intronic
1133068773 16:3231383-3231405 TAAGAGTTTGACAGTCATAATGG + Intronic
1133655670 16:7861313-7861335 TAATAGAATGTTAGTTGTCATGG + Intergenic
1134183190 16:12063794-12063816 TACGAGATTGTCACTTTTAGGGG - Intronic
1134768918 16:16787356-16787378 TACGATATTGTCAGTTTTTAAGG + Intergenic
1138152925 16:54675917-54675939 TAACAGTTTCTCAGTTGGAAAGG - Intergenic
1138156326 16:54708225-54708247 TAAGAAAGTGTCATTTGTAAGGG - Intergenic
1140051266 16:71483520-71483542 GCAGAGAATCTCAGTTGTAATGG - Intronic
1142650685 17:1349418-1349440 TCAGAGTTTGTTAGTTGTACCGG + Intronic
1143831333 17:9654045-9654067 TTAGAGATTTTGAGTTGGAAGGG + Intronic
1145162983 17:20588722-20588744 TAAAAAATTGCCATTTGTAAAGG + Intergenic
1147194825 17:38759190-38759212 TAAAATATTGTAAGTTGAAATGG + Intronic
1150173546 17:63024910-63024932 TAAGAGATTTTAAGTTGCTAAGG + Intronic
1153347626 18:4045104-4045126 TAAGAGACGGTCTGTTCTAATGG + Intronic
1153446620 18:5179987-5180009 TAAGGGATTATCAGTTGAAAAGG + Intronic
1155683815 18:28521811-28521833 TCAGAGATTCTCAGTTATACTGG - Intergenic
1157851676 18:51059226-51059248 TAAGAGAATGTAATTTTTAATGG + Intronic
1158608105 18:58913982-58914004 TTAGAGAATGTCAGTATTAAAGG - Intronic
1167133690 19:47604073-47604095 TAATAGATTGTGAGTTGTGTGGG + Intergenic
925372109 2:3353527-3353549 TATGAAATTGCCACTTGTAATGG - Intronic
926938398 2:18110206-18110228 TAATAGAATGTCAGTGTTAAAGG + Intronic
929095050 2:38255151-38255173 TAAAAGAGTGTCAGGTGTAGTGG - Intergenic
930127584 2:47814672-47814694 TAAGAGATTGCCAGTTGGTCAGG - Intronic
931878841 2:66544652-66544674 TAAGAAATTTTCAGTTGTTCGGG - Intronic
936717106 2:115200301-115200323 GCAGAGATTGCCAGTAGTAATGG - Intronic
936856053 2:116958434-116958456 AAGGAAATTGTCATTTGTAAAGG - Intergenic
937194565 2:120140984-120141006 TAAGACATTCTCAGTTCTTAGGG - Intronic
937540042 2:122938177-122938199 TAAGAGTTTGTCAGTAGATATGG - Intergenic
939177461 2:138765981-138766003 TCAGATATTATCAGTTGTTAGGG - Intronic
941327034 2:164128787-164128809 GCAGAGATTGTCAGTAGGAAGGG + Intergenic
942941857 2:181628142-181628164 TAAGAGTTTGTCAGTGGTCATGG - Intronic
945594587 2:211775951-211775973 CAAGAGATGGTGAGTTGTATCGG + Intronic
946487660 2:220116409-220116431 CAAGAGCTTGACAGTTGGAAAGG + Intergenic
948245883 2:236485669-236485691 TAAGGGATTGTCACATGAAAGGG + Intronic
1169337276 20:4766607-4766629 GAAAAGATTGTCACTTGTATTGG - Intergenic
1170472326 20:16680693-16680715 TAAAAGAATGTCAGTTGTTCAGG - Intergenic
1179104479 21:38386486-38386508 TAAAAAATTGTCAGTGGTAAAGG + Intronic
1179402338 21:41095834-41095856 TATGAGAGTGTCACTTGTGACGG - Intergenic
1180718614 22:17889957-17889979 TAACAGCTTGTCAGGTCTAAGGG - Intronic
1180868987 22:19135395-19135417 TGAGAGATTGTCAGAGGTCATGG - Intronic
952422840 3:33146761-33146783 TGTTAGATTGTCAGTTGGAAGGG + Exonic
952908505 3:38163028-38163050 AAAGAAACTGTCAGTAGTAATGG + Intergenic
959162007 3:102735303-102735325 TAAGAAATTCTCATTTATAAAGG + Intergenic
960437986 3:117650980-117651002 TAAGTGATTGTCAATTGTGAAGG + Intergenic
967971947 3:195005752-195005774 TATGTAATTGTCAGCTGTAAAGG + Intergenic
969668417 4:8575509-8575531 TAAGAGATTATCAGATGGTAAGG - Intronic
969887874 4:10232451-10232473 AAAGAGACTAGCAGTTGTAAAGG - Intergenic
971746854 4:30591775-30591797 GAAGTGTTTGTCAGTTGTATTGG + Intergenic
972954412 4:44371260-44371282 TAAGAGATTAGCATTTGAAAAGG - Intronic
973306299 4:48655140-48655162 TAAGAGATATTCAGTGGTAGTGG + Intronic
974160238 4:58129346-58129368 TAAGTGATAGTAAGTTGTATTGG - Intergenic
974734165 4:65907476-65907498 CAAAAGATTGTCAGTTCAAAGGG - Intergenic
975041888 4:69755243-69755265 TAATAGATTGACAGTTGTTCTGG + Exonic
976050503 4:81006818-81006840 TAAGAGTTTGTCTTTTGAAATGG + Intergenic
978759471 4:112340646-112340668 TAAGAAATTTTCAGGTGAAAAGG - Intronic
979126180 4:116975377-116975399 CAAGACATGGTCATTTGTAAAGG + Intergenic
981897534 4:149820846-149820868 AAAGAAATTGTCAGATGTAAGGG - Intergenic
988058159 5:26128128-26128150 TAAGACATTGACATTTGTAGAGG - Intergenic
988063529 5:26204376-26204398 TAAGAAATTATCAGTTGTTAAGG - Intergenic
990152867 5:52840128-52840150 TAAGATATTGCCAGTTATAAAGG - Intronic
990950202 5:61291182-61291204 TACTAGATTGGCTGTTGTAAGGG - Intergenic
992052317 5:72952652-72952674 CAAGAGATTGCCTGTTGGAAAGG - Intergenic
992883646 5:81135449-81135471 AAAGAGATTAGCAGTTGCAAAGG - Intronic
1000552152 5:162680291-162680313 TAAGAGTCTGACACTTGTAAAGG - Intergenic
1004053485 6:12111723-12111745 TAAGAGATTCTCCATTGTTATGG + Intronic
1004347787 6:14864393-14864415 TGAGTGATTGTCAGTTGCAGAGG - Intergenic
1004523930 6:16388150-16388172 TAAGAGACTGTCAGTGGTCAAGG - Intronic
1006222264 6:32501241-32501263 TTAGTGGTTGTCAGTTGTCAGGG - Intergenic
1007312602 6:40958519-40958541 TGACATATGGTCAGTTGTAAAGG - Intergenic
1010881623 6:81181551-81181573 TAAGAGATGCTCAGTTATTAGGG + Intergenic
1012025217 6:93981073-93981095 TAAGAGATGGTAAAATGTAAAGG + Intergenic
1014694293 6:124599571-124599593 TAAGAGATGCTCAGTTTTGAAGG - Intronic
1015162313 6:130167153-130167175 TAAAAGAGTGTCAGTTTAAAAGG + Intronic
1016405102 6:143721436-143721458 TAAGAATTTTTGAGTTGTAAAGG + Intronic
1018404788 6:163467884-163467906 TACGATATTTTCAGTTGCAATGG - Intronic
1021137551 7:16984429-16984451 TCTGAGGTTGTCAGTGGTAATGG - Intergenic
1022626906 7:32045856-32045878 TAATAGATTGTCACATGTGAAGG - Intronic
1023166881 7:37351689-37351711 TAGGAGTTTTTCAATTGTAAGGG - Intronic
1026503389 7:70961819-70961841 TAAGAGACTGCCAGGTGTAGTGG - Intergenic
1027840253 7:83301075-83301097 AAAGGGAGTGTCAGTGGTAATGG + Intergenic
1028403739 7:90453947-90453969 TTAGTGATTGACAGTTATAATGG + Intronic
1028735032 7:94199451-94199473 AACTACATTGTCAGTTGTAATGG - Intergenic
1035555984 8:567629-567651 TAAGAGAATCTCATTTTTAATGG - Intergenic
1038835788 8:31121077-31121099 TATGAGATTTTTTGTTGTAAAGG + Intronic
1039336843 8:36600857-36600879 CAACAGAATGTCAGCTGTAAAGG + Intergenic
1042785415 8:72540238-72540260 TAAGAGATAGCAAGTTTTAAAGG - Intronic
1043187627 8:77174440-77174462 TAAGAGAGTGTCAGTCGAATAGG - Intergenic
1043189231 8:77196496-77196518 AAAGAAGTTGTCAGGTGTAATGG + Intergenic
1043378446 8:79676223-79676245 TAAGAGAATGTAAGTTGTCTAGG - Intergenic
1043774868 8:84253855-84253877 TAAGAGATTGGCAGTAGGCAAGG - Intronic
1045475037 8:102545446-102545468 TAAGAGATAGGCAGTTGTGGTGG + Intergenic
1045904697 8:107330690-107330712 TAAGACATAGTCAGTGGGAATGG + Intronic
1050051474 9:1606739-1606761 TAAGAGACTGTCAGTCACAAAGG - Intergenic
1052037465 9:23699018-23699040 TAAGAGATTGTCAGTTGTAAGGG - Intronic
1059740663 9:117146357-117146379 TAAGAGATTGTCAAGCTTAATGG + Intronic
1060124939 9:121034497-121034519 TAATAGATTGTCAGTTTAAAAGG - Intronic
1186432376 X:9515863-9515885 TAAGAGGTTGTCACTGCTAAAGG + Intronic
1188263867 X:28046275-28046297 TAAGATATTTTCATTTATAAAGG + Intergenic
1189702686 X:43727963-43727985 TAAGAAATTATGAGTTGAAAAGG - Intronic
1192053600 X:67749099-67749121 TGAGAGATGGACAGTTGTTAGGG - Intergenic
1193140854 X:78025048-78025070 TAGGAGATTGTTAGCTCTAATGG + Intronic
1194191546 X:90842483-90842505 TTTGAGATTGTCAGTTTTTAAGG + Intergenic
1194969647 X:100328955-100328977 TAAGAGATGGTTAGTTGGAATGG + Intronic
1197394641 X:125911601-125911623 TCAGAGATTCTCACTTGAAATGG + Intergenic
1198152190 X:133922254-133922276 TGAGAGATTCTCAGTGGGAAAGG - Intronic
1200538187 Y:4424921-4424943 TTTGAGATTGTCAGTTTTTAAGG + Intergenic
1200915031 Y:8564077-8564099 TCAGAGGTTGGCAGCTGTAATGG - Intergenic
1201686028 Y:16703248-16703270 TGAGACATTGCCAGGTGTAATGG - Intergenic