ID: 1052037466

View in Genome Browser
Species Human (GRCh38)
Location 9:23699019-23699041
Sequence ATAAGAGATTGTCAGTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052037466_1052037467 6 Left 1052037466 9:23699019-23699041 CCTTACAACTGACAATCTCTTAT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1052037467 9:23699048-23699070 CTTCCAAAATGTCTTTCTATAGG No data
1052037466_1052037469 14 Left 1052037466 9:23699019-23699041 CCTTACAACTGACAATCTCTTAT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052037466 Original CRISPR ATAAGAGATTGTCAGTTGTA AGG (reversed) Intronic
903737013 1:25536330-25536352 ATAGGAGTTTGCCAGTTGGAGGG + Intergenic
905981125 1:42229107-42229129 ATATGAGTTTGTCATTGGTATGG - Intronic
909443814 1:75725639-75725661 ATATAAGAGTGTCAGTTTTATGG - Intronic
912386104 1:109271951-109271973 ATGAGAGATTCTCAGGTGCAAGG - Intronic
915008101 1:152659264-152659286 TTAAGAGGGTATCAGTTGTAAGG + Intergenic
915957831 1:160237924-160237946 TTAACTGATTTTCAGTTGTAAGG - Intronic
917020405 1:170580533-170580555 TTAAGAGATTGTCAGTGCCAGGG + Intergenic
919019642 1:192087841-192087863 AGAAGAGATTGGCATTTGAATGG - Intergenic
924082579 1:240414513-240414535 ATAAAATATTGGCATTTGTAGGG + Intronic
1064939814 10:20721364-20721386 ATAAGAGATTATCTGTTCCATGG - Intergenic
1064954984 10:20898228-20898250 TTAATAAATTGTGAGTTGTAGGG - Intronic
1067257124 10:44652240-44652262 CTAAGACATTGTCAGTTTTGAGG + Intergenic
1068155528 10:53192836-53192858 ATAAGAAAATGTCAGTGGAATGG - Intergenic
1069517396 10:69089312-69089334 ATAAAACATTGTCAATTGTAGGG + Intronic
1071991726 10:91106097-91106119 ACAAGACAGTGTCAGTTGCAGGG - Intergenic
1073859309 10:107719288-107719310 ATATTAGATTGTCAGGTGCAAGG + Intergenic
1074166535 10:110882491-110882513 ATAACATATTGCTAGTTGTATGG + Intronic
1079221732 11:18568538-18568560 ATAAAAATTTGTCAGTTGGAAGG - Intronic
1079522187 11:21340946-21340968 ATAAGAGAATGTGAGAAGTATGG - Intronic
1079608293 11:22397792-22397814 ATAAGACCTTGTCAGCTGTGTGG + Intergenic
1086358724 11:86034776-86034798 AAAAGTGATTGTCATTTCTATGG - Intronic
1087228670 11:95632481-95632503 TGAAGAGCTTCTCAGTTGTAAGG + Intergenic
1087297307 11:96391374-96391396 ATAAGAGACTGGCAGGTTTAAGG - Exonic
1088409790 11:109521616-109521638 ATAAGAGCATGTCATTTGCAGGG - Intergenic
1093068684 12:14686017-14686039 ATAAGAGAATGACAGTTATGGGG + Intronic
1095548501 12:43402621-43402643 ATAATACATTCTAAGTTGTAAGG + Intronic
1098578809 12:72074823-72074845 ATATTAGAATGTCAGTTATAAGG - Intronic
1098591372 12:72217488-72217510 ATAAGAGATTGACAGATGCAAGG - Intronic
1101563190 12:105879763-105879785 CTAAGAGATTAACAGTTATATGG + Intergenic
1106871039 13:34021035-34021057 GTAAGAGATTAGCAGTGGTAAGG - Intergenic
1107531824 13:41289904-41289926 AGAAGAGATAGTCAGTTGGCGGG - Intergenic
1107799605 13:44092942-44092964 TTAAGAGATTATAAGTTATAAGG + Intergenic
1108703840 13:52967282-52967304 ATAAGGGATTGTTAATTTTAAGG + Intergenic
1109074349 13:57815350-57815372 AGAACTGATTGTCAGTGGTAAGG + Intergenic
1109997711 13:70151315-70151337 ATAATAGAATGTCAGTTGCCGGG - Intergenic
1110098172 13:71558554-71558576 ATAAGATATTGTCATTGGAAAGG - Intronic
1110379065 13:74828629-74828651 ACAAGATATTGTCATTTGAAGGG - Intergenic
1111755126 13:92383095-92383117 ATATGAGATTGTCCTTTTTATGG - Intronic
1111851498 13:93581712-93581734 AAAAGAAAATCTCAGTTGTAAGG + Intronic
1113556912 13:111243656-111243678 GTAAGATAAAGTCAGTTGTATGG + Intronic
1114542194 14:23469396-23469418 ATAATTGATTGACAGTTGGAAGG - Intergenic
1115287960 14:31738282-31738304 ATAAGAGGTTGCCAGTTATATGG + Intronic
1115803322 14:37021306-37021328 GTAAGAGGTTGTCATTTGTTTGG - Intronic
1116331661 14:43604469-43604491 ATGAGAGATAATCAGTTGAAGGG + Intergenic
1117209694 14:53482666-53482688 ATAAGAAATTATGATTTGTAGGG + Intergenic
1117263653 14:54063173-54063195 ATAGCATATTGTCATTTGTAAGG - Intergenic
1118474040 14:66100778-66100800 AAAAGAGATTATCAGTAGAAAGG - Intergenic
1124818753 15:33021832-33021854 AAAGGAGATTGTAAGTTTTAGGG - Intronic
1124930040 15:34110695-34110717 GTAAGAGGTAGTCAGTTATAAGG + Intergenic
1125292238 15:38162933-38162955 TTAAGATATTGTCAGATTTAAGG + Intergenic
1126668781 15:51096998-51097020 ATAATAGCTTTTCAGTTATAAGG + Intronic
1126867275 15:52950066-52950088 AGAAGAGATTGTCAGTGTAAAGG - Intergenic
1127078375 15:55350652-55350674 ACAAAAGATTGTCAGTGTTAAGG + Intronic
1129127536 15:73456827-73456849 ATAAGATATTAACAGTTTTAAGG - Intronic
1130399017 15:83531652-83531674 ATAACTCATTGGCAGTTGTATGG + Intronic
1131861454 15:96658110-96658132 ATGGGAGATTTTCAGTTGAATGG - Intergenic
1134183191 16:12063795-12063817 CTACGAGATTGTCACTTTTAGGG - Intronic
1138156327 16:54708226-54708248 GTAAGAAAGTGTCATTTGTAAGG - Intergenic
1138953340 16:61941195-61941217 AAAAGACAGTTTCAGTTGTATGG + Intronic
1139355208 16:66363525-66363547 ATCAGAGTTTGTCAGTGGTGGGG - Intergenic
1142532317 17:589283-589305 ATAAAATATTGTCAGTAGTTGGG - Intronic
1143006600 17:3839872-3839894 ATAAGAGATTGTCTTTTCTGAGG - Intronic
1149126395 17:53239417-53239439 ATAAGAAAATATCTGTTGTAGGG - Intergenic
1149522116 17:57325411-57325433 ATAAGTGGTTTTCAGTTGCATGG - Intronic
1152488902 17:80615455-80615477 ATAAGAAATTGTCAAATATATGG + Intronic
1153610897 18:6883660-6883682 ATAATAGATCCTAAGTTGTATGG + Intronic
1157596631 18:48868080-48868102 ATGAGAGGTTGTCTGTTGTCTGG - Intergenic
1158767086 18:60464906-60464928 ATAAAAGATTATCTGTTGTTGGG - Intergenic
1159088613 18:63821875-63821897 AGAAGAGATTCTCAGTTGCGTGG - Intergenic
1159985745 18:74839066-74839088 ACAAGAAATTGTCCGTTTTAGGG - Intronic
1164239835 19:23375941-23375963 ATAAGAAAATATCAGTTGCATGG + Intronic
1165137734 19:33680782-33680804 ATAAGAGATAGTCATTTCCATGG - Intronic
1167133689 19:47604072-47604094 CTAATAGATTGTGAGTTGTGTGG + Intergenic
925541822 2:4975481-4975503 AGAAGAGATTGACAGTAGAATGG + Intergenic
927249530 2:20985162-20985184 ATAAGTGATTCTCAGTTCTTGGG - Intergenic
930156137 2:48109444-48109466 ATAAAACATTGTCAGTAGTAGGG - Intergenic
930790276 2:55319306-55319328 GAAAGGAATTGTCAGTTGTATGG + Intronic
931878842 2:66544653-66544675 TTAAGAAATTTTCAGTTGTTCGG - Intronic
933500279 2:83102341-83102363 ATAAGAAATTAGCAGTTTTATGG - Intergenic
937260294 2:120581229-120581251 AGAAAAGATTTTAAGTTGTATGG - Intergenic
939392712 2:141589606-141589628 ATAAGATTTTGTCAGTTCTAAGG + Intronic
941296832 2:163749261-163749283 TTAAGAGAATGTCAGTTTTAGGG - Intergenic
944199856 2:197095020-197095042 ATAAGAGAGTTTCAGGTGGAGGG - Intronic
946798768 2:223386588-223386610 ATTAGAGAATATCAGTTGGAAGG + Intergenic
1169856145 20:10105417-10105439 TTAAGAAATTGTCACTTTTAAGG - Intergenic
1170178627 20:13502506-13502528 ATAATATATTGTTAGTTTTATGG - Intronic
950349883 3:12339279-12339301 ATAATAGATTAACAGTTGTCTGG + Intronic
951895635 3:27607379-27607401 AAAAGATGTTGTAAGTTGTAAGG + Intergenic
952232511 3:31446840-31446862 CTAAGACACTGTCAGTTTTAAGG - Intergenic
952473590 3:33682793-33682815 AAAACAAATTGTCAGTTGTTTGG + Intronic
956293747 3:67690006-67690028 AAAAGAGATTGTCAAGTGAAAGG - Intergenic
956395685 3:68823763-68823785 ATAAGATAATGTCCTTTGTAGGG - Intronic
958112404 3:89165471-89165493 TTAAGAGATGGTCTGTTCTATGG - Intronic
959271319 3:104214388-104214410 ATAAGAAATATTCAGTTGAATGG + Intergenic
959384991 3:105692969-105692991 ATAAGAGATTATCAGATAAAAGG + Intronic
961344531 3:126255200-126255222 ATTATAGAGAGTCAGTTGTAGGG + Intergenic
964279021 3:155041897-155041919 AAAGGAGATTGTCAGTAGCACGG + Intronic
965312524 3:167148533-167148555 ATAAGAGATTGACATTTCAAGGG - Intergenic
967735669 3:192949294-192949316 AGAAAAGGTTGGCAGTTGTAAGG + Intergenic
970441107 4:16082283-16082305 ATAAGAAATTGTCGGTTTTTTGG - Intronic
970922200 4:21407845-21407867 AAAAGTTATAGTCAGTTGTAAGG + Intronic
974293527 4:59964562-59964584 ATAAGAGAATCTCAATTTTATGG + Intergenic
974324584 4:60397297-60397319 ATAAGAAATTGTAAGATTTAAGG - Intergenic
974374168 4:61055289-61055311 ATAACAGATTGGCATCTGTAAGG - Intergenic
974523187 4:63012250-63012272 ATTAGAGATATTCAGTTTTAGGG + Intergenic
974734166 4:65907477-65907499 ACAAAAGATTGTCAGTTCAAAGG - Intergenic
977015483 4:91687575-91687597 ATTAGATATTTTCAGGTGTATGG + Intergenic
977050826 4:92127390-92127412 GAAAAAGATTTTCAGTTGTAAGG + Intergenic
980179408 4:129385893-129385915 AAAATAGAATGACAGTTGTAGGG + Intergenic
981897535 4:149820847-149820869 AAAAGAAATTGTCAGATGTAAGG - Intergenic
983557365 4:169070434-169070456 ATAAGAGATTACCGGTTGTCTGG + Intergenic
990749912 5:59003356-59003378 AGATGGGATTGTCAGCTGTATGG - Intronic
994776339 5:104039656-104039678 AGAAGAGATTGGCATTTGAATGG + Intergenic
995084464 5:108091118-108091140 ATAAGTGGTTGTATGTTGTAAGG - Intronic
995781239 5:115777591-115777613 AGAAGAGATGGGCAGCTGTAAGG - Intergenic
996312627 5:122123836-122123858 ATTAGAGATAGTAAGTTATAAGG - Intergenic
996352489 5:122560957-122560979 ATAAGTGATTGTTAGTTAAAGGG - Intergenic
999954601 5:156686854-156686876 AAAAGAAATGGTCAGTTTTAAGG - Intronic
1000409330 5:160921678-160921700 ATAAGACATTGTCATTTCAATGG - Intergenic
1001059959 5:168479749-168479771 ATAAGAATTTGTAAGTTGTTGGG - Intergenic
1005460258 6:26062021-26062043 ATAAGAATTTGTCAATTGTGAGG + Intergenic
1006089938 6:31622403-31622425 AGAAGAGATTATTACTTGTAGGG + Intronic
1006222265 6:32501242-32501264 ATTAGTGGTTGTCAGTTGTCAGG - Intergenic
1007977117 6:46113108-46113130 ATATGAGATTGTGAGTTGGAGGG + Intergenic
1010665500 6:78625276-78625298 AAAAGAGATTGTCAGTGTGATGG - Intergenic
1010816724 6:80366524-80366546 ATAACACATTATCACTTGTAGGG - Intergenic
1014978641 6:127920522-127920544 GTAAGAAATTGTCAGTTGATAGG - Intergenic
1016255689 6:142102446-142102468 ATTATAGATATTCAGTTGTAGGG - Intergenic
1016504822 6:144766963-144766985 ATAACAGACTGGCAGTTGGAGGG + Intronic
1019085478 6:169471697-169471719 GTAAGACATTGTTAGTTTTAAGG + Intronic
1020682740 7:11256942-11256964 ATTTGAGCTTGTCAGTTTTAGGG + Intergenic
1021706162 7:23370062-23370084 ATAAGAGGTTGTCAGTTACCTGG + Intronic
1022600538 7:31754712-31754734 ATCAGAGATTGTCAGGCGTTTGG + Intronic
1025289471 7:57702057-57702079 TTAAGAAATTGTCAGTTTAAAGG + Intergenic
1027468500 7:78544445-78544467 TTAATAGTTTGTCATTTGTAAGG + Intronic
1030793961 7:113764218-113764240 ATAAAATATTTTCAGTTATATGG - Intergenic
1036082039 8:5567838-5567860 ATAAGAAAGTGTCTGTTCTAGGG + Intergenic
1050037509 9:1452907-1452929 ATCAGAGATTGTCAGGGGTTTGG + Intergenic
1051144891 9:14016540-14016562 AAAAAAGAATGTCAGATGTAAGG + Intergenic
1052037466 9:23699019-23699041 ATAAGAGATTGTCAGTTGTAAGG - Intronic
1053502265 9:38608769-38608791 ATAAGAGATTTTCATTATTATGG + Intergenic
1053874895 9:42534256-42534278 ATAAGAGAATGAAAGTTGGAGGG + Intergenic
1053897721 9:42760334-42760356 ATAAGAGAATGAAAGTTGGAGGG - Intergenic
1055695576 9:78880395-78880417 ATTAGAGATTGCCACTTGTAAGG + Intergenic
1058586218 9:106509063-106509085 CTTAGAGCTTTTCAGTTGTAGGG + Intergenic
1186695129 X:12022398-12022420 ATCAGAGATTTTCAGTACTAGGG + Intergenic
1188824868 X:34819326-34819348 AAGAGAGATTGTTGGTTGTATGG + Intergenic
1189118133 X:38364825-38364847 TTAAGAGTTTGTCAGTTGGTTGG - Intronic
1194375107 X:93122768-93122790 ATAACAGTTTGTGAGTTCTAAGG - Intergenic
1198611826 X:138410561-138410583 AAAAGAGATTGTCAGATAAAGGG + Intergenic
1201532040 Y:15002083-15002105 ATAAGAGAGTGCCTGTTTTATGG + Intergenic