ID: 1052037469

View in Genome Browser
Species Human (GRCh38)
Location 9:23699056-23699078
Sequence ATGTCTTTCTATAGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052037464_1052037469 23 Left 1052037464 9:23699010-23699032 CCAAGTTTCCCTTACAACTGACA 0: 1
1: 0
2: 3
3: 15
4: 175
Right 1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG No data
1052037465_1052037469 15 Left 1052037465 9:23699018-23699040 CCCTTACAACTGACAATCTCTTA 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG No data
1052037466_1052037469 14 Left 1052037466 9:23699019-23699041 CCTTACAACTGACAATCTCTTAT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052037469 Original CRISPR ATGTCTTTCTATAGGAGTGA AGG Intronic
No off target data available for this crispr