ID: 1052039268

View in Genome Browser
Species Human (GRCh38)
Location 9:23719745-23719767
Sequence CACTGGGTAGGGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052039258_1052039268 19 Left 1052039258 9:23719703-23719725 CCCATTTATTGAGGCCCTGGCTA 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG No data
1052039260_1052039268 5 Left 1052039260 9:23719717-23719739 CCCTGGCTAGAAAGCTCAAATAT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG No data
1052039261_1052039268 4 Left 1052039261 9:23719718-23719740 CCTGGCTAGAAAGCTCAAATATC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG No data
1052039259_1052039268 18 Left 1052039259 9:23719704-23719726 CCATTTATTGAGGCCCTGGCTAG 0: 1
1: 0
2: 1
3: 17
4: 87
Right 1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052039268 Original CRISPR CACTGGGTAGGGAAGGAAGA GGG Intronic
No off target data available for this crispr