ID: 1052042481

View in Genome Browser
Species Human (GRCh38)
Location 9:23754887-23754909
Sequence GCTTACTTCTGAACTGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052042481 Original CRISPR GCTTACTTCTGAACTGGTAC AGG (reversed) Intronic
902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG + Intronic
908225610 1:62053090-62053112 GCTTACTTGGGAACTGGGAGTGG - Intronic
917990760 1:180376207-180376229 GCTCTCTTATGAACTGGTAGTGG + Intronic
924700400 1:246445802-246445824 TCTCACTTCTGAAATGGGACCGG + Intronic
1063469043 10:6269747-6269769 GCTGACTTCTGAAGTTGTCCAGG - Intergenic
1064157621 10:12916710-12916732 GCTCACATCTGATCTGGAACCGG + Intronic
1070157164 10:73842376-73842398 GCTTCCTTCTGAAATGGGGCAGG + Intronic
1073149571 10:101302605-101302627 GGTTCCTTCTGAACTCTTACTGG + Intergenic
1073421034 10:103423826-103423848 GCTGACTTCTGTTCTGGTTCCGG + Intronic
1076320004 10:129571263-129571285 TCTTACTTCTTAAATGATACAGG + Intronic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1080856638 11:36117445-36117467 GCTGACTTCTGAACTGATCTTGG + Intronic
1083836637 11:65273402-65273424 GCATCCTTGAGAACTGGTACTGG + Intronic
1086323825 11:85678208-85678230 GCTGACTTCAGAACTGGTGTAGG - Intronic
1092302564 12:7265943-7265965 GCTGACTTCAGAACTGTGACAGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1107610049 13:42104037-42104059 ACATACCTCTGAACTGTTACTGG - Intronic
1111372839 13:87338984-87339006 GCTATTTTCTGTACTGGTACAGG + Intergenic
1112567129 13:100561290-100561312 GCTTACATCTGACTTGGTAATGG + Intronic
1112823054 13:103357989-103358011 GCTTAGGACTGAGCTGGTACTGG + Intergenic
1120488547 14:85146945-85146967 GCTAACCTCTGAACTGCTAGAGG + Intergenic
1129070132 15:72944048-72944070 TCTTTCTTCTGAATTGGAACTGG - Intergenic
1142969560 17:3601902-3601924 GCTCACTTCTAAACTCCTACAGG + Intergenic
1153690789 18:7591486-7591508 GAATACTTCTGAACTTGTAGTGG - Intronic
1155842231 18:30659800-30659822 GCTTACTTCTGTACTCTTGCTGG - Intergenic
1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG + Intergenic
1159223444 18:65497895-65497917 GATTACTTCTCTACAGGTACAGG - Intergenic
925838513 2:7968723-7968745 GCTTACTTGGGAAGTGGTGCTGG - Intergenic
930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG + Intergenic
934556654 2:95290079-95290101 GCTTCCTTCTGAAGAGGTAAGGG - Exonic
1169361272 20:4951317-4951339 GCTTACTTCTGAGTTAGTGCTGG - Intronic
1173790041 20:45822638-45822660 GCTTACTCCTCAAATTGTACTGG - Intergenic
1176992235 21:15511130-15511152 ACCTGCTTCTGAACTGATACTGG - Intergenic
963264378 3:143226225-143226247 GCTTCCTTCTGCACTTTTACTGG - Intergenic
963826082 3:149955468-149955490 GATTTCTTGGGAACTGGTACAGG + Intronic
964417274 3:156460562-156460584 GCTTAATTCTGTACTCGTGCTGG - Intronic
965368192 3:167825225-167825247 GTTTACTTCTGAACCAATACAGG + Exonic
967302770 3:188031965-188031987 GGTGACTTCTGAACTGGGACAGG - Intergenic
967896786 3:194401871-194401893 GCAGACTTCTGACCTGGTAATGG - Intergenic
970323640 4:14900506-14900528 GCTGACTTCTGAACTGGAAAAGG - Intergenic
975672931 4:76799955-76799977 GCTTACTTCAGAATTGAGACAGG + Intergenic
976380167 4:84389867-84389889 TCTTACTTCTGAACTGAGCCAGG - Intergenic
977238792 4:94541640-94541662 CCTCACTTCTCAACTGGTAATGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
981979564 4:150774704-150774726 GGTTACTTCTAACCTTGTACTGG + Intronic
992656578 5:78916321-78916343 CCTTTCTTCTGGACTGGAACAGG - Intronic
996449341 5:123601495-123601517 GCTTCCTTCTGGTCTGGTTCTGG + Intronic
1018647426 6:165961367-165961389 GCTTCCTTCTGAAGTAGGACAGG - Intronic
1020231610 7:6323472-6323494 GCTTATTTTTGAAGTGATACGGG - Intergenic
1024993085 7:55251542-55251564 CCTTCCTTCTTAACTAGTACAGG - Intronic
1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG + Intronic
1030640045 7:111994491-111994513 GCCTAGTCGTGAACTGGTACTGG - Intronic
1039247830 8:35629100-35629122 GCTTGCTACTGAAATAGTACTGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039869131 8:41530397-41530419 GCTTACTTTAGAACAGGGACTGG + Intronic
1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056535936 9:87527724-87527746 GCTTCTTTCTGAACTGTTACTGG + Intronic
1058123876 9:101169534-101169556 GCTTTCTTCTCAACTGCTTCAGG + Intronic
1059930178 9:119252795-119252817 TCATTCTTCTGTACTGGTACTGG - Intronic
1060713698 9:125898551-125898573 ACTAAATTCTGAACTGGTTCAGG + Intronic
1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG + Exonic
1186551346 X:10509044-10509066 GTTTTCTTCTGAAATGGTAGTGG + Intronic
1190364046 X:49675168-49675190 GCTTGCTTCAAAACTGGTTCTGG + Intergenic
1192352643 X:70370309-70370331 GCTTACTTCTGGAGGGGGACTGG + Intronic
1195024354 X:100861342-100861364 GCTTAGTTCTCATCTGGAACAGG - Intronic
1198830378 X:140744178-140744200 GCCAACTTCTGATCTGTTACTGG + Intergenic
1201448387 Y:14083126-14083148 GTTTACTTCTGGACAGGTTCTGG - Intergenic