ID: 1052042802

View in Genome Browser
Species Human (GRCh38)
Location 9:23758729-23758751
Sequence CTCTATGATCAAATAAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052042796_1052042802 -5 Left 1052042796 9:23758711-23758733 CCACAGTCCCCAAATAGGCTCTA 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1052042802 9:23758729-23758751 CTCTATGATCAAATAAGGCCGGG No data
1052042795_1052042802 -4 Left 1052042795 9:23758710-23758732 CCCACAGTCCCCAAATAGGCTCT 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1052042802 9:23758729-23758751 CTCTATGATCAAATAAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052042802 Original CRISPR CTCTATGATCAAATAAGGCC GGG Intronic
No off target data available for this crispr