ID: 1052044335

View in Genome Browser
Species Human (GRCh38)
Location 9:23776703-23776725
Sequence TAGCATAGGTCAGGTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052044335_1052044338 19 Left 1052044335 9:23776703-23776725 CCTTCTCTACCTGACCTATGCTA 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1052044338 9:23776745-23776767 AAAAAAAAAAAAAAAAAAGATGG 0: 2880
1: 30954
2: 37506
3: 74036
4: 136962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052044335 Original CRISPR TAGCATAGGTCAGGTAGAGA AGG (reversed) Intronic
901568947 1:10143426-10143448 AAGCAAAGGTCAGAGAGAGAAGG - Intronic
910646273 1:89518713-89518735 TAGTATAGTTCAGGCAGAGTGGG + Intergenic
911345339 1:96690140-96690162 TAGAAAAGGTCAGGCAGAGTTGG - Intergenic
912505733 1:110154611-110154633 CAGTAGAGGTCAGGAAGAGAAGG - Intronic
912649802 1:111427571-111427593 AAGCCTAGATTAGGTAGAGATGG - Intronic
920716295 1:208343520-208343542 CAGGACAGGTCAGGTAGGGAAGG - Intergenic
923577875 1:235176835-235176857 TAGCAAAGGTCAGGCAGTGGAGG + Intronic
923593884 1:235345156-235345178 GAGTACAGGTGAGGTAGAGAAGG - Intergenic
1063678526 10:8163584-8163606 TAACAGAGGTGAGGAAGAGATGG - Intergenic
1064321198 10:14306569-14306591 GAGCAGAGGCCTGGTAGAGAGGG - Intronic
1065636060 10:27735796-27735818 CAGAATAGGTCAGGTCAAGAGGG + Intronic
1068045495 10:51881071-51881093 AAGCATAGTTCAGGTAAAGAGGG + Intronic
1069117295 10:64523517-64523539 TAGCATGGGTCAGATACAGTCGG - Intergenic
1073626794 10:105106324-105106346 TACCAGGGGTCAGGTAGAGAAGG - Intronic
1074296582 10:112194972-112194994 TAGGATAGTGCAGGTGGAGAGGG - Intronic
1074756860 10:116630078-116630100 TAGCACAGGTCAGCAGGAGATGG - Intronic
1075183521 10:120233586-120233608 TTGCAGAGAGCAGGTAGAGAGGG + Intergenic
1084290131 11:68159059-68159081 TAGCTTAGATGAGGTAGAGTTGG + Exonic
1085613368 11:77973592-77973614 TAGAATAGGTCAGGAATAGATGG - Intronic
1085909560 11:80805397-80805419 AGGCATAGGTCAGCTGGAGATGG + Intergenic
1087091353 11:94276723-94276745 TAGCATAGGTATAGTAGATATGG - Intergenic
1087413454 11:97822189-97822211 TAACATGAGTCAGGTATAGAGGG - Intergenic
1088842685 11:113639978-113640000 TAGGACAGTTCAGGTGGAGAGGG + Intergenic
1088842714 11:113640118-113640140 TAGAGTGGGTCAGGTGGAGAGGG + Intergenic
1091903974 12:4167977-4167999 TAGTATTGGCCAGGTAAAGAAGG - Intergenic
1092724735 12:11474469-11474491 TGGCAGAGGTGTGGTAGAGAAGG + Intronic
1095047197 12:37520529-37520551 TAGCAAAGGGCAGATACAGACGG - Intergenic
1095218168 12:39574880-39574902 TACCACAGGTCAGGTAGTCAGGG + Intronic
1100687914 12:97006865-97006887 TAGCATAGGGAAGGAAGAGGTGG - Intergenic
1103156527 12:118689844-118689866 TAGAATTGGTGAGGTAGACATGG + Intergenic
1106934058 13:34698749-34698771 TAGTATGGGTCAGATAGAGCCGG - Intergenic
1109341634 13:61068645-61068667 AAGCATAGGGCAGTTAGATAGGG + Intergenic
1109530691 13:63642119-63642141 TACCACAGGTCAGGTAGTGGAGG - Intergenic
1111079039 13:83277891-83277913 TAGAATACGTGAGGGAGAGAAGG - Intergenic
1112411225 13:99165311-99165333 TAGCAAGGGCCAGGTAGAGAAGG + Intergenic
1112477495 13:99745168-99745190 CAGAATAGGTCAGTTAGAGATGG - Intronic
1121840448 14:97129612-97129634 TAGCAGAGGTCTTGGAGAGAGGG + Intergenic
1122241727 14:100372902-100372924 CAGCAGAGTTCAGGCAGAGAAGG - Intronic
1130336336 15:82960049-82960071 TGGCATGGGTCAGGTTCAGATGG + Intronic
1131182731 15:90251517-90251539 TAGCATAAATCAGGAAGAGTGGG - Intronic
1131549693 15:93346722-93346744 TAGCAGAGGTAAAGGAGAGATGG + Intergenic
1134352439 16:13450384-13450406 TAGCATAGATCAGTGGGAGATGG - Intergenic
1134827347 16:17295277-17295299 AAGCTTAGGTCAGGAAGAAATGG + Intronic
1138245949 16:55467338-55467360 TGGAATGGGGCAGGTAGAGAAGG + Intronic
1146072642 17:29698166-29698188 TTGCTTAGGGCTGGTAGAGAGGG + Intronic
1148199578 17:45740951-45740973 CACCATAAGGCAGGTAGAGAGGG + Intergenic
1148611654 17:48968725-48968747 TAGCACAGTTCAGGTGGAAAGGG - Intergenic
1149030558 17:52078245-52078267 TAGCACAGTTGAGGTAGGGAAGG + Intronic
1149361538 17:55900521-55900543 GAGCATAGGTCAGACAGAGCTGG + Intergenic
1149656117 17:58310409-58310431 GAGCAGAGGACAGGCAGAGAGGG + Intronic
1150984494 17:70180247-70180269 TAGAATAGGCTAGGTAGAAAGGG + Intergenic
1150997542 17:70336198-70336220 TAGCATAGGCCAAGTAGCGTGGG - Intergenic
1153171617 18:2323094-2323116 TAGCATAAGGCAGGTAGGAAGGG + Intergenic
1153779920 18:8485407-8485429 TGGCATGGACCAGGTAGAGATGG + Intergenic
1157246775 18:46061616-46061638 TAACATAGGACAGGTAGATGAGG + Intronic
1157405601 18:47420106-47420128 TAGCAAAGTTCTGGAAGAGATGG + Intergenic
1157733113 18:50021830-50021852 TAACATAGATCTGGTACAGAAGG - Intronic
1158278779 18:55797858-55797880 TAAAATAAGACAGGTAGAGAGGG - Intergenic
1158736808 18:60091749-60091771 GAGCATGTGTCAGGTAGGGAAGG - Intergenic
1159858431 18:73616971-73616993 TAGCATAGCTGAGAGAGAGAAGG - Intergenic
1160572075 18:79824472-79824494 AAGCATAGAGCAGGTAAAGAAGG - Intergenic
1164050703 19:21584053-21584075 TCAGATAGGTCTGGTAGAGATGG - Intergenic
1164882673 19:31748114-31748136 TACCATGGGCCAGGTAGAGTCGG - Intergenic
926661362 2:15470686-15470708 TATTATAGATCTGGTAGAGATGG - Intronic
928251592 2:29685945-29685967 AAGCACAGGTCAGAGAGAGATGG - Intronic
930049751 2:47205816-47205838 AAGCATAGGTGAAGTAGAGAAGG + Intergenic
932119716 2:69087527-69087549 GAGCATAGGTCAGGTAAATACGG + Intronic
932504922 2:72219589-72219611 TAGCTTAGGTTAGATAGAGTAGG - Intronic
936244861 2:110817662-110817684 TATCCTAGGTCAGGTAGTTAGGG + Intronic
936565928 2:113582780-113582802 TACCAGAGGTAAGGAAGAGATGG - Intergenic
938575268 2:132597537-132597559 TAGCACTTGTCAAGTAGAGAAGG + Intronic
939484664 2:142795963-142795985 TAGCATAGGCAAGGTTGAAAGGG + Intergenic
942822984 2:180138469-180138491 TAGAAAAGGTCATGGAGAGAGGG + Intergenic
944507620 2:200429127-200429149 CAGCATAGCTAAAGTAGAGAGGG - Intronic
947288401 2:228543911-228543933 TATCAGAGGTAAGGTACAGATGG + Intergenic
948342718 2:237268330-237268352 CAGCAGAGGTGAGGGAGAGAAGG - Intergenic
1169916327 20:10687253-10687275 GAGCAGAGGTAAAGTAGAGATGG + Intergenic
1171393989 20:24819191-24819213 TAGCGTGGGACAGGCAGAGATGG + Intergenic
1171541756 20:25963991-25964013 TAGCAAAGGGCAGATACAGATGG - Intergenic
1171844753 20:30260147-30260169 TAGCAAAGGGCAGATACAGACGG - Intergenic
1173887429 20:46472668-46472690 GAGAATAGGTCAGGTAGGTAGGG + Intergenic
1174927082 20:54772127-54772149 TAGCAGTGGGCAGGAAGAGAGGG + Intergenic
1175092527 20:56516829-56516851 TAGCATCGGTCAGTCAGACAGGG + Intronic
1175444300 20:59009466-59009488 TGGAATAGGGCAGGAAGAGAGGG + Intergenic
1178112796 21:29385914-29385936 TGGCATAGGACAGATAGAGGAGG - Intronic
1178761824 21:35410470-35410492 CAGCACAGGACAGGGAGAGAGGG + Intronic
1182245766 22:28956246-28956268 TAGTATGGATAAGGTAGAGAGGG + Intronic
1182447534 22:30398209-30398231 CAGGAGAGGTCAGGCAGAGAAGG + Intronic
1182825520 22:33261391-33261413 GAGCATAGGTAAAGAAGAGAGGG - Intronic
1184626106 22:45731527-45731549 TATGAATGGTCAGGTAGAGAGGG + Intronic
1185132107 22:49045070-49045092 CAGCTGAGGTCAGGAAGAGAAGG - Intergenic
951461427 3:22955684-22955706 TAACATAGATTAGGTAGAGAGGG - Intergenic
952312408 3:32201915-32201937 CAGCATAGGTGAAGTAGAGGAGG - Intergenic
952644094 3:35635540-35635562 TAACATAGGCTGGGTAGAGAGGG + Intergenic
955707317 3:61741694-61741716 TAGCAGAGGTCAAGTCGACATGG + Intronic
956935817 3:74100717-74100739 TAGGAGAGGTCAGGTATAAATGG + Intergenic
957452327 3:80395381-80395403 TAAAATAGGTAAGGGAGAGAGGG - Intergenic
961703472 3:128765273-128765295 TAGCAGAGGAGAGGTAGAAAAGG - Intronic
965762537 3:172094411-172094433 TAGAAAAGGCCAGTTAGAGAAGG - Intronic
969386599 4:6853985-6854007 TAGCGTTGGTCAGAGAGAGAAGG + Intronic
970174475 4:13325141-13325163 GAGGATTGGACAGGTAGAGATGG - Intergenic
971499920 4:27307599-27307621 TATGATAGGTCATGTAGGGATGG - Intergenic
974961790 4:68711396-68711418 TAGCATAGGTCATTAGGAGAAGG + Intergenic
975169527 4:71216865-71216887 TAGCATAGAGCAGGTAGACAAGG - Intronic
975914169 4:79303446-79303468 TAACAAAGGTCAGGAAGAGCGGG - Intronic
976473763 4:85459240-85459262 TAGCATATCTCAGGTACATAGGG + Intergenic
979597063 4:122545885-122545907 AGGCATAGGTAAGGAAGAGAGGG + Intergenic
979807045 4:124987227-124987249 TAGCACATGTCAGGGAGAGGAGG - Intergenic
982888779 4:160820070-160820092 TAGCATAGGTCTGGAGCAGAAGG + Intergenic
983142189 4:164164899-164164921 TTGAATGGGTCAGGGAGAGAAGG - Intronic
990028697 5:51228211-51228233 AAACATGGGTGAGGTAGAGAGGG + Intergenic
990992630 5:61700603-61700625 TAGCAAAGGTTAGGTAAGGAAGG - Intronic
991354573 5:65754611-65754633 TAGAAAAGGTCAGGAAGAGAAGG - Intronic
995062216 5:107823242-107823264 CAGCATAGGTGAGGTGGAAATGG - Intergenic
997483348 5:134206828-134206850 TAGCATGGGGCTGGTACAGATGG - Intronic
997759175 5:136428347-136428369 TAGCATAGGAAAGAGAGAGATGG - Intergenic
998918324 5:147040465-147040487 TAGCCCAGGTCAGTTAGACAGGG + Intronic
1000612156 5:163386140-163386162 TAGTATATGTCAGGTAGGGTTGG + Intergenic
1000813278 5:165889158-165889180 GAGCACATTTCAGGTAGAGAAGG - Intergenic
1003153501 6:3572117-3572139 TAGCATAGCTGGGGTTGAGAAGG + Intergenic
1005754012 6:28909521-28909543 GATCATAGCTCAGGAAGAGAAGG - Intronic
1006303355 6:33205532-33205554 TAGGAAAGGTCAGGTTGAGTTGG + Exonic
1006751545 6:36381009-36381031 TAGCTTTGGTCAGGTGGGGAGGG - Intronic
1006812523 6:36829184-36829206 GAGCCAAGGTCAGGTAGAAACGG + Intronic
1007082512 6:39117852-39117874 GAGCATAGAACAGGTAGAGAAGG + Intergenic
1007653235 6:43436030-43436052 TAGCTTTGGGCAGGTAGATATGG + Intronic
1017609943 6:156174700-156174722 TGGTGTAGGCCAGGTAGAGAAGG + Intergenic
1022590930 7:31662029-31662051 TAGCATAGGTCACATAGAGCTGG - Intergenic
1023272300 7:38477253-38477275 CAGAATTGGTCAGGGAGAGAAGG + Intronic
1025293209 7:57750314-57750336 TAGCAAAGGGCAGATACAGATGG - Intergenic
1029032167 7:97479976-97479998 TAACGTTGGTCAGGAAGAGATGG + Intergenic
1033597026 7:142865779-142865801 AAGGATGGGTCAGGGAGAGAAGG - Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG + Intronic
1044365253 8:91337537-91337559 TAGCATATGTCAGTAACAGAAGG + Intronic
1049143058 8:140975379-140975401 TAGGTTGGGTCGGGTAGAGAAGG - Intronic
1052044335 9:23776703-23776725 TAGCATAGGTCAGGTAGAGAAGG - Intronic
1058152253 9:101476171-101476193 TAGCATGGGTCTGGTGGAGCTGG - Exonic
1194472239 X:94310808-94310830 TAGCATAGGTAAAGTCAAGAAGG + Intergenic
1194546273 X:95239055-95239077 TACCAAGGGTCAGGGAGAGATGG - Intergenic
1195321121 X:103722897-103722919 TTGCACATGTCAGGTAGAGATGG + Intronic