ID: 1052045740

View in Genome Browser
Species Human (GRCh38)
Location 9:23792201-23792223
Sequence GTTCTAAGCAGATTTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052045737_1052045740 0 Left 1052045737 9:23792178-23792200 CCCAATTATAGGCTAATGCAAGT 0: 1
1: 7
2: 73
3: 323
4: 583
Right 1052045740 9:23792201-23792223 GTTCTAAGCAGATTTAAGGCAGG No data
1052045738_1052045740 -1 Left 1052045738 9:23792179-23792201 CCAATTATAGGCTAATGCAAGTG 0: 1
1: 7
2: 76
3: 336
4: 573
Right 1052045740 9:23792201-23792223 GTTCTAAGCAGATTTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052045740 Original CRISPR GTTCTAAGCAGATTTAAGGC AGG Intronic
No off target data available for this crispr