ID: 1052048239

View in Genome Browser
Species Human (GRCh38)
Location 9:23820014-23820036
Sequence CACCATTTATATATACCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052048234_1052048239 22 Left 1052048234 9:23819969-23819991 CCTACCACAAATGCAGTAACATT 0: 1
1: 0
2: 2
3: 17
4: 282
Right 1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG No data
1052048238_1052048239 -6 Left 1052048238 9:23819997-23820019 CCACTCAGCAATACAGTCACCAT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG No data
1052048232_1052048239 24 Left 1052048232 9:23819967-23819989 CCCCTACCACAAATGCAGTAACA 0: 1
1: 0
2: 0
3: 7
4: 185
Right 1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG No data
1052048233_1052048239 23 Left 1052048233 9:23819968-23819990 CCCTACCACAAATGCAGTAACAT 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG No data
1052048236_1052048239 18 Left 1052048236 9:23819973-23819995 CCACAAATGCAGTAACATTCGGG 0: 1
1: 0
2: 1
3: 16
4: 117
Right 1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052048239 Original CRISPR CACCATTTATATATACCCAA AGG Intronic
No off target data available for this crispr