ID: 1052048316

View in Genome Browser
Species Human (GRCh38)
Location 9:23820736-23820758
Sequence CCGTGCACCCCGGCCGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052048307_1052048316 28 Left 1052048307 9:23820685-23820707 CCAGTGAACCGACGCTGGCTCCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data
1052048312_1052048316 5 Left 1052048312 9:23820708-23820730 CCAGTCTCACCAGTGCACGCACA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data
1052048313_1052048316 -4 Left 1052048313 9:23820717-23820739 CCAGTGCACGCACACTAGTCCGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data
1052048310_1052048316 7 Left 1052048310 9:23820706-23820728 CCCCAGTCTCACCAGTGCACGCA 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data
1052048308_1052048316 20 Left 1052048308 9:23820693-23820715 CCGACGCTGGCTCCCCCAGTCTC 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data
1052048311_1052048316 6 Left 1052048311 9:23820707-23820729 CCCAGTCTCACCAGTGCACGCAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data
1052048309_1052048316 8 Left 1052048309 9:23820705-23820727 CCCCCAGTCTCACCAGTGCACGC 0: 1
1: 0
2: 4
3: 11
4: 116
Right 1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052048316 Original CRISPR CCGTGCACCCCGGCCGCCGC TGG Intronic
No off target data available for this crispr