ID: 1052049169

View in Genome Browser
Species Human (GRCh38)
Location 9:23825425-23825447
Sequence TGGCTCAGCAACGGAAGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052049169 Original CRISPR TGGCTCAGCAACGGAAGGAC GGG (reversed) Intronic
900596273 1:3481552-3481574 TGGCACAGCAAGAGGAGGACTGG + Intergenic
901833351 1:11907337-11907359 TGGCTGAGCAGGGGAAGGCCTGG - Intergenic
902554209 1:17237465-17237487 TGGCTCAGGCAGGGAAGGAGGGG - Intronic
902659024 1:17888442-17888464 AGGCTCAGCGGCGGAAGGAGAGG - Intergenic
904897063 1:33825204-33825226 TGGCTGAGCAAAGAGAGGACTGG - Intronic
907221669 1:52911618-52911640 TGGCCCAGCTGCGGGAGGACCGG - Exonic
907610944 1:55870469-55870491 TGGCTCACCAATGAAAGGAATGG - Intergenic
912558809 1:110535528-110535550 TGCCCCAGCAACCGGAGGACAGG - Intergenic
915145822 1:153795262-153795284 TGGGTCAGCAAAGGAGGAACAGG - Intergenic
915729392 1:158042502-158042524 TAGCTCTGCAAGGGAGGGACTGG - Intronic
915837808 1:159191872-159191894 TGGCTCAGAAATGGGAGGAGGGG + Intronic
916068793 1:161157972-161157994 AGGCTCAGCAAAGGAGGGCCTGG - Intronic
916407973 1:164516162-164516184 TGAATCAGCAAGGGAAGGGCAGG - Intergenic
916679181 1:167088847-167088869 TGGCCCAGCCAGGGAAGGATGGG + Intronic
920204714 1:204283056-204283078 TGCCTCAGCCACTGAAGGGCAGG - Intronic
921047999 1:211491034-211491056 TGCCTCAGAATGGGAAGGACTGG - Intronic
922466988 1:225851171-225851193 GGGCTCAGCATGGGAAGGGCTGG - Intronic
924425291 1:243944677-243944699 TGACTCAGCAAGGGCAGGCCAGG - Intergenic
1063689939 10:8277343-8277365 TGGCAGAGCAATGGAAGGCCAGG - Intergenic
1074992040 10:118717809-118717831 TGGGTCATCAAGAGAAGGACTGG + Intronic
1075773244 10:124959128-124959150 TAGCTCAGCAGAGGAAGTACAGG + Intronic
1076614667 10:131747610-131747632 TGGCTCAGCCACGTACAGACGGG + Intergenic
1077179976 11:1207918-1207940 AGGCTCAGCAACGCCAGGGCAGG + Intergenic
1077289318 11:1781644-1781666 GGTCTCAGCAGTGGAAGGACGGG - Intergenic
1084852859 11:71957368-71957390 TGGCTCATGACCGGTAGGACTGG + Intronic
1087733114 11:101800678-101800700 TAGCTCAGCTAGGGAAGGAGTGG - Intronic
1087928451 11:103948022-103948044 TAGCTGAGGAAAGGAAGGACTGG - Intronic
1089207796 11:116778919-116778941 TGGCTCCGCAACGGTAGCAGTGG - Exonic
1090358942 11:126159751-126159773 AGGCTCAGCACGGGAAGGTCAGG - Intergenic
1092090079 12:5797192-5797214 TGGCTCAGGAAGGGAACCACAGG + Intronic
1096399374 12:51292208-51292230 TGTCTCAGCAACTGAAGATCTGG - Exonic
1096464303 12:51839774-51839796 TGGCTGAGCAGCGGAGGGAATGG - Intergenic
1101147551 12:101855401-101855423 TGCATCAGCACTGGAAGGACAGG - Intergenic
1101437654 12:104677842-104677864 TGGAACAGCAACTGAGGGACAGG - Intronic
1102228759 12:111248017-111248039 TGCCTCAGCAACCGAAGTACAGG + Intronic
1104083941 12:125457681-125457703 GGGCTCTGCAAGGGAAGGGCTGG + Intronic
1105293746 13:19071170-19071192 TGACTCAGCACAGGAAGGTCAGG + Intergenic
1105303963 13:19156511-19156533 TTGCTCAGCATTGGGAGGACAGG + Intergenic
1111042670 13:82770448-82770470 TAGCTCAGCAACAGCAGGATAGG - Intergenic
1113119729 13:106913560-106913582 TGGCTCATTTACTGAAGGACAGG + Intergenic
1117161487 14:52994531-52994553 CAGCTCAGCAACAGCAGGACAGG - Intergenic
1119905446 14:78297962-78297984 TGGCCCAGCGCAGGAAGGACAGG - Intronic
1121829432 14:97036876-97036898 TGGCTCTGGAACGGAATGACAGG + Intergenic
1131069487 15:89456818-89456840 TGGAGCAGCAAAGGAAGGAGGGG + Intergenic
1131557256 15:93410645-93410667 TGTCTATGCAATGGAAGGACTGG + Intergenic
1133777013 16:8904465-8904487 AGGCTCAGAAGCGGAAGGAGCGG - Exonic
1139267666 16:65655540-65655562 TGGCTCTGCAACGGTAAGAAAGG - Intergenic
1146502074 17:33372848-33372870 GGTCTCAGCAGTGGAAGGACAGG + Intronic
1146685026 17:34835741-34835763 GGGGTCAGCAAGGGAAGGCCTGG + Intergenic
1147612959 17:41812294-41812316 GGGCGCAGCGACGGAAGGCCCGG - Intronic
1149006808 17:51814706-51814728 TGACTCAGAAACAGAAGAACTGG - Intronic
1150636144 17:66914672-66914694 TGGTCCAGCAAGGGAAGGCCTGG - Intergenic
1152395811 17:80032312-80032334 AGGCTCAGCAACAGAAGGGCAGG + Intronic
1152633325 17:81420411-81420433 TGGCCCAGCAGCGGGAAGACTGG - Intronic
1152818626 17:82424122-82424144 TGGCTCAGCTTGGGAGGGACGGG - Intronic
1160123391 18:76149575-76149597 TGGCTCAGCAGAGGATGGAAGGG - Intergenic
1160123494 18:76150717-76150739 TGGCTCAGCAGAGGACGGAAGGG + Intergenic
1163846052 19:19638544-19638566 TGGCGCAGGAATGGAAGGACTGG - Intronic
1165137587 19:33679605-33679627 TGTCTCAGTAACTGAAGGTCAGG + Intronic
1165839372 19:38778767-38778789 TTGTTCAGCAAAGGAAGGAAAGG - Intergenic
926606804 2:14906445-14906467 TGGCTCAGCTACTGAAGGCACGG + Intergenic
926693135 2:15751098-15751120 TGGCTGAGAAAAGGCAGGACTGG - Intergenic
927183908 2:20468400-20468422 TGGCTCTGCCTTGGAAGGACGGG + Intergenic
929529284 2:42736967-42736989 TGGCTCAGCCACAGTAGGATGGG - Intronic
932107175 2:68954754-68954776 TGTCTCAGCAAGGCAAGGAGAGG - Intergenic
934149415 2:89131032-89131054 TGGTTCAGCAACAGAAGGAGTGG + Intergenic
934217879 2:90051009-90051031 TGGTTCAGCAACAGAAGGAGTGG - Intergenic
936760357 2:115771655-115771677 TAGCACAGCAAGGGAAGGAAAGG - Intronic
937157934 2:119734411-119734433 TGGCTTTGCAAGGGATGGACTGG - Intergenic
941851859 2:170191171-170191193 CAGCTCAGCCACGGTAGGACAGG - Intronic
942604411 2:177675412-177675434 GGGCTCAGCAGAGGAGGGACTGG - Intronic
945148766 2:206765779-206765801 CGGCCCAGCTGCGGAAGGACAGG + Intronic
947605513 2:231483255-231483277 AGGCTGAGCAACGGCAGGAAAGG - Intronic
947923344 2:233898760-233898782 TGGCTCAGCCAAGGATGGAAAGG - Intergenic
948774619 2:240277521-240277543 TAGCTCAGCAACAGCAGGATAGG + Intergenic
1171878337 20:30598566-30598588 TGACTCAGCACAGGAAGGTCAGG + Intergenic
1173617779 20:44414131-44414153 TCACTCAGCAAGGGAAGGGCTGG - Intronic
1174848736 20:53970184-53970206 AGGCTCAGCAAGGGAACCACTGG - Intronic
1177295033 21:19162793-19162815 CAGCTCAGCCACAGAAGGACAGG - Intergenic
1182605152 22:31497016-31497038 TGGCCCAGGAGCGGAAGGGCTGG + Intronic
1183566955 22:38622380-38622402 TGGCCCTGCAACAGAGGGACTGG + Intronic
1184559420 22:45253322-45253344 TGGCTCCGCAACTGAAAGACTGG - Intergenic
1185081874 22:48714000-48714022 TGGCACAGACACGGGAGGACTGG - Intronic
955951315 3:64245267-64245289 TGGGTCAGATAAGGAAGGACGGG + Intronic
957323493 3:78662531-78662553 TGGCTAAGCAATGGAAAGAAAGG + Intronic
958757890 3:98271973-98271995 TAGCTCAGCCACAGAAAGACAGG - Intergenic
962025829 3:131546634-131546656 TGGGTCTGCAATGAAAGGACAGG - Intronic
962477094 3:135764541-135764563 AGGCTCTGCAACAGAAGAACAGG + Intergenic
966003902 3:174984525-174984547 TGGATCAGAAACTCAAGGACAGG + Intronic
966816096 3:183891017-183891039 TGGCTCAAGAAGGGAGGGACTGG - Intergenic
969154799 4:5201086-5201108 TGGCTCAGCAATGGAAAGTCAGG + Intronic
976168010 4:82275781-82275803 TGTCTCAGCAACTGAAGATCTGG + Intergenic
977696055 4:99967835-99967857 TTGCTGAGCAACTGAAGGATAGG - Intergenic
983443178 4:167814287-167814309 TGCCTCAGCAAGGGAAGGTTGGG + Intergenic
986896518 5:12377214-12377236 TGGGTCAGCAAGGGTTGGACTGG + Intergenic
987031492 5:13980482-13980504 TGCCTTAGCAATGGAAGGAGGGG - Intergenic
996675018 5:126165236-126165258 TGGCACAGAAACTGCAGGACAGG + Intergenic
999101046 5:149026634-149026656 TGGCTCAGCAACTCAGGGACCGG - Exonic
999425746 5:151486527-151486549 TGGCTGAGCAGCTGAAGGATTGG - Intronic
999940349 5:156535799-156535821 TGGCTCATCAAAGACAGGACAGG - Intronic
1002309576 5:178306460-178306482 CGGCTCTGCCAAGGAAGGACAGG + Intronic
1002470509 5:179432651-179432673 TGGCTGAGCAAGGGAAGGGCCGG - Intergenic
1013402290 6:109810373-109810395 CAGCTCAGCAGCGGAAGGAATGG - Intronic
1013485273 6:110590560-110590582 GGGGTCAGCCACGAAAGGACAGG + Intergenic
1017976131 6:159359000-159359022 TGGCTGAGCCACGGAAGGTTGGG - Intergenic
1020813269 7:12872394-12872416 TGGCTCAGCAGCAGGAGGTCTGG + Intergenic
1023127925 7:36973841-36973863 TTGCTCGGCAACGGCAGGGCCGG - Intronic
1032075170 7:128832618-128832640 TGGCTCAGCAGAGGAGGGGCTGG + Intronic
1032125114 7:129188323-129188345 TGGCTCAGGATGGGAAAGACAGG - Intergenic
1033617342 7:143029320-143029342 TGGCTCAGCACTAGCAGGACAGG - Intergenic
1034576731 7:152006194-152006216 TGGATCAGCGAGAGAAGGACTGG + Intronic
1035968404 8:4220659-4220681 TGGCTTAGCAAAAGAAGGAAAGG + Intronic
1037828021 8:22171107-22171129 TGGCTCAGCAACTGATGGGACGG - Intronic
1038036429 8:23690572-23690594 TGGCTCAGCCAGGGAGGGAGGGG + Intergenic
1038989982 8:32857574-32857596 TGGCTCAGCAGAGAAAGGAAAGG + Intergenic
1044489721 8:92799093-92799115 TGGCTCAGCAAGGGAGAGCCCGG - Intergenic
1047420838 8:124707033-124707055 TGGCTCAGAAAGAGAAGGAATGG - Intronic
1047971013 8:130084561-130084583 TGGCTCAGCAGCGAATGGCCAGG + Intronic
1049766946 8:144359309-144359331 TGGGTCAGCACCGGACGGGCGGG - Exonic
1049929391 9:441467-441489 TGGCTAAGCATCTGTAGGACAGG - Intronic
1050018367 9:1259588-1259610 TGGCTCACCAAGGGTGGGACTGG + Intergenic
1052049169 9:23825425-23825447 TGGCTCAGCAACGGAAGGACGGG - Intronic
1052481878 9:29039836-29039858 AAGCACAGCAACGGTAGGACAGG + Intergenic
1054153493 9:61624069-61624091 AGGCTAAGGAAGGGAAGGACCGG + Intergenic
1054473286 9:65555270-65555292 AGGCTAAGGAAGGGAAGGACCGG + Intergenic
1054982545 9:71223214-71223236 TGGCTCAGCTACAGAAGGACAGG + Intronic
1055149080 9:72973381-72973403 TGACTCAGCAATGGATGCACTGG + Intronic
1055692365 9:78846267-78846289 TGGCTCAGCCACAGCAGGATAGG - Intergenic
1060801775 9:126549597-126549619 TCGCTCAGCAAGAGAGGGACTGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1186677515 X:11834333-11834355 TGGAGAACCAACGGAAGGACTGG - Intergenic
1186952486 X:14642466-14642488 TGACTCAGCAGAAGAAGGACAGG - Intronic
1187702271 X:21974095-21974117 TTGCTGAGCAACGGAAATACAGG + Intronic
1188425044 X:30036706-30036728 TAGCTCAGCTACAGTAGGACAGG - Intergenic
1188479927 X:30627144-30627166 GGGCACAGCAACTGAAAGACAGG - Intergenic
1193417022 X:81237895-81237917 TAGCTCAGCCACAGCAGGACAGG + Intronic
1194692967 X:97009774-97009796 CAGCTCAGCCACAGAAGGACAGG - Intronic