ID: 1052049585

View in Genome Browser
Species Human (GRCh38)
Location 9:23830208-23830230
Sequence CAGGGAGAAGAACGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 1, 2: 3, 3: 59, 4: 780}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052049585_1052049594 0 Left 1052049585 9:23830208-23830230 CCCTCCCCCCGTTCTTCTCCCTG 0: 1
1: 1
2: 3
3: 59
4: 780
Right 1052049594 9:23830231-23830253 CTCCCTCCACCCCCTAGCAAAGG 0: 1
1: 0
2: 6
3: 34
4: 278
1052049585_1052049595 1 Left 1052049585 9:23830208-23830230 CCCTCCCCCCGTTCTTCTCCCTG 0: 1
1: 1
2: 3
3: 59
4: 780
Right 1052049595 9:23830232-23830254 TCCCTCCACCCCCTAGCAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 220
1052049585_1052049604 18 Left 1052049585 9:23830208-23830230 CCCTCCCCCCGTTCTTCTCCCTG 0: 1
1: 1
2: 3
3: 59
4: 780
Right 1052049604 9:23830249-23830271 AAAGGGGTAAAGCCTTTTACTGG 0: 1
1: 0
2: 7
3: 18
4: 143
1052049585_1052049605 22 Left 1052049585 9:23830208-23830230 CCCTCCCCCCGTTCTTCTCCCTG 0: 1
1: 1
2: 3
3: 59
4: 780
Right 1052049605 9:23830253-23830275 GGGTAAAGCCTTTTACTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 217
1052049585_1052049597 2 Left 1052049585 9:23830208-23830230 CCCTCCCCCCGTTCTTCTCCCTG 0: 1
1: 1
2: 3
3: 59
4: 780
Right 1052049597 9:23830233-23830255 CCCTCCACCCCCTAGCAAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052049585 Original CRISPR CAGGGAGAAGAACGGGGGGA GGG (reversed) Intergenic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
900918872 1:5658412-5658434 CTGGGAGAAGGAGGTGGGGAAGG - Intergenic
901029128 1:6296369-6296391 CAGGGATGAGAACTGGGGGTGGG - Intronic
901036417 1:6338764-6338786 CAGGGAGAGGACCAGGGGCAGGG + Intronic
901666328 1:10828275-10828297 AGGGGAGAAGAAAGGGGGCAGGG - Intergenic
901699847 1:11039456-11039478 AAGGTAGAAGAATGGGTGGATGG + Intronic
901700460 1:11042504-11042526 TAGGTAGAAGAATGGGTGGATGG + Intronic
901877273 1:12174002-12174024 CAGGGGGGAGTGCGGGGGGAGGG + Intronic
902130531 1:14256499-14256521 CAGAGAGAGGAAAGGAGGGAGGG + Intergenic
902359759 1:15935978-15936000 CAGGGACAGGGACGGGGGCAGGG - Exonic
902365813 1:15973608-15973630 CGGGGAGCAGATCTGGGGGAGGG - Intronic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
903190974 1:21655847-21655869 CAGGGAGATGGAAGGGGAGAGGG + Intronic
903285800 1:22275917-22275939 CAGGGAGAGGAAGCTGGGGAAGG + Intergenic
903331618 1:22599782-22599804 GAGGGAAAAGAAAGGAGGGAAGG + Intronic
903417459 1:23193689-23193711 CCGCCAGAAGAGCGGGGGGATGG + Exonic
904277493 1:29393934-29393956 AAGGGAGAAGGAGGGGAGGAGGG - Intergenic
904437179 1:30506558-30506580 GTGGGAGAAGAACGGGGACAGGG + Intergenic
904612603 1:31733658-31733680 CAGGGAGAAGACAGGGGGCCAGG + Intronic
904933644 1:34110743-34110765 GAGGGTGGAGAACGGGAGGAGGG + Intronic
905105960 1:35563745-35563767 CCTGGAAAAGAAAGGGGGGAAGG - Exonic
906191983 1:43904794-43904816 CAGGAAGAGGAACAGGAGGAGGG - Intronic
907099351 1:51814142-51814164 GAGGGAGAAGGGCGGGAGGAGGG + Intronic
907903908 1:58766825-58766847 CAGGGAGAAGGAAGGAGGGCAGG - Intergenic
908221745 1:62014068-62014090 GAGTGAGAAGAATGGGGGGCTGG - Intronic
908262483 1:62349591-62349613 AAGGGAGAGGAAGGGAGGGAGGG + Intergenic
908516448 1:64897463-64897485 GAGGGAGGAGGAGGGGGGGAGGG + Intronic
910491145 1:87773039-87773061 AAGGGAGAAAAAAGGGGAGAAGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911335251 1:96573832-96573854 CTGGGTGAAGAACGGGGACAGGG - Intergenic
911449811 1:98048597-98048619 GAGGGTGGAGAAGGGGGGGAGGG - Intergenic
912519212 1:110233868-110233890 CAGGGAGGAGCAGGGAGGGAGGG - Exonic
912674457 1:111664569-111664591 CAGGGAGAGGAAGGGGGTGTAGG - Intronic
913325991 1:117629407-117629429 GAGGAAGAAGATCGTGGGGATGG - Intergenic
914754419 1:150554585-150554607 CAGGGAGAAGAAAGAAGGCATGG - Intronic
914827071 1:151144311-151144333 CAGGGAGCAGAAAGAGGGGCTGG - Intronic
915111591 1:153567340-153567362 CGGGGAGAAGGATGGGGGCAAGG + Intronic
915447023 1:155979631-155979653 GTGGGAGAAGAAGGGAGGGAGGG + Intronic
915598649 1:156909056-156909078 CAGAGAGAAGACTTGGGGGATGG + Intronic
915725145 1:158011903-158011925 GAGGGGGAAGAGCTGGGGGAGGG - Intronic
915839081 1:159201102-159201124 GAGGGAGGAGGGCGGGGGGAGGG + Exonic
915920312 1:159971467-159971489 CAGGGAGAAGTCCAGGGTGAAGG + Intergenic
916292397 1:163180988-163181010 TAGGGATAAGAACAGGGGGGCGG - Intronic
916340609 1:163729327-163729349 CATGTAGAAGAAGGGGGGAAAGG + Intergenic
916804225 1:168243211-168243233 CAGGGAGAGGGAGGGAGGGATGG - Exonic
916875736 1:168966588-168966610 GAGAGAGAGGGACGGGGGGAAGG + Intergenic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
917930282 1:179818034-179818056 CAGGGAGAAGAGCTGGGTCAGGG - Intergenic
918373700 1:183887194-183887216 AAGAGAGAAGAAGGAGGGGAAGG - Intronic
918476835 1:184934318-184934340 GAGGGAGAAGGAAGGGAGGAGGG + Intronic
919245447 1:194977499-194977521 GAGGGAGAAGAGTGGGAGGAGGG - Intergenic
919465395 1:197918231-197918253 CAGGGAGAGGAACTGGGAGGAGG + Intronic
919604936 1:199669969-199669991 CAGGGACAAGAACCAGAGGAAGG + Intergenic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920198256 1:204243598-204243620 CAGGGAGAGGAACAAGGGAAAGG - Intronic
920398333 1:205662065-205662087 CAGAGAGAAGACCAGGGAGATGG + Exonic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
920447707 1:206032044-206032066 CATGGAGACTAACGGAGGGAAGG - Intergenic
920860121 1:209699094-209699116 GAGGGAGGAGAACAGGAGGAAGG + Intronic
920915420 1:210254374-210254396 CAGGGAGCAGAAGGTGGGGCTGG - Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922287641 1:224183592-224183614 CTGGGCGAGGAGCGGGGGGAGGG + Intronic
922453082 1:225752277-225752299 CAGGGGGAAGAAAATGGGGAGGG - Intergenic
922880344 1:228975738-228975760 CAGGGACAAGGAGGTGGGGAGGG - Intergenic
923214341 1:231834662-231834684 AAGGGAGAAGAAGGGGGCAATGG + Intronic
924005122 1:239600676-239600698 AAGGGAGAAGAAAGGAAGGAAGG - Intronic
924143194 1:241047402-241047424 GAGAGAGAAGAAAGGTGGGAGGG - Intronic
924172551 1:241357151-241357173 CCGGGAGAAGAAGCGGAGGAGGG - Exonic
924423944 1:243933833-243933855 AAGGGAGAGGAAGGGAGGGAGGG - Intergenic
924743797 1:246814055-246814077 CATGGGGAAGAACGGGGGGAAGG - Intergenic
1062803196 10:395136-395158 GAGGGAGGAGATGGGGGGGAGGG + Intronic
1062818243 10:516486-516508 AAGGGAGGGGAAAGGGGGGAAGG + Intronic
1062818275 10:516545-516567 AAGGGAGGGGAAAGGGGGGAAGG + Intronic
1062818329 10:516644-516666 AAGGGAGGGGAAAGGGGGGAAGG + Intronic
1063438560 10:6054033-6054055 GAGGAAGAGGAACGGGTGGAGGG - Intronic
1064351117 10:14577970-14577992 CACTGGGAAGAACTGGGGGAAGG - Intronic
1064949182 10:20827922-20827944 GAGGGTGAAGAAGGAGGGGAGGG + Intronic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066487044 10:35856166-35856188 GAGGGAGAAGAAGGGAGGGAAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1068739330 10:60451075-60451097 GAGGGAGAGGCACGGGAGGAAGG + Intronic
1069629535 10:69889295-69889317 CAGGGAGGAGCACGGGGGGCAGG + Intronic
1069629542 10:69889314-69889336 CAGGGAGGAGCACAGGGGGCAGG + Intronic
1070276011 10:75007406-75007428 CAAGGAAAAGAAAGGGGTGAAGG + Intronic
1070312545 10:75284158-75284180 GAGGGAGAAGAAGGGAGGGAAGG + Intergenic
1070577994 10:77694406-77694428 CAGGGAGAGGTAGGTGGGGAAGG - Intergenic
1070689130 10:78511701-78511723 GAAGGAGAAGAAGGAGGGGATGG + Intergenic
1071268401 10:83984582-83984604 CAGGGAGAAGAAATCAGGGAAGG + Intergenic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072759252 10:98042327-98042349 CAGTGAGCAGGACTGGGGGATGG - Intergenic
1072787400 10:98293615-98293637 CAGGAAGAGGAACTGGAGGACGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073436286 10:103518321-103518343 AAGGGAGAGGAAGAGGGGGAAGG - Intronic
1074722511 10:116274483-116274505 CGGGGAGAAGAAGAGGAGGAAGG + Intergenic
1074864232 10:117535611-117535633 CAGGAAGAAGAAAGAGGGCAGGG + Intergenic
1074924676 10:118055470-118055492 CAGGGAGAAGGATAGGGAGATGG + Intergenic
1075161672 10:120029660-120029682 AAGGGGGAAGGAGGGGGGGAGGG + Intergenic
1075299334 10:121307412-121307434 CAGGGAGCAGAAGGGAAGGATGG - Intergenic
1075590560 10:123688199-123688221 CGGTGAGAAGAAGGGTGGGAGGG + Exonic
1075685876 10:124364776-124364798 GAGGGAGAAGAGGGGAGGGAGGG + Intergenic
1075722565 10:124595984-124596006 CAGGCAGAAGACGGGGGTGAAGG - Intronic
1076040932 10:127247893-127247915 CAGGGAGAAGCAACGGGGCATGG - Intronic
1076349770 10:129807998-129808020 CAGGGAGGAGAAAGGGAGGCAGG - Intergenic
1076457556 10:130611280-130611302 CAGGGAGAAGAAGAGGAGGGAGG + Intergenic
1076516150 10:131045452-131045474 AAGGGAGAAGAAAGGAGGAAGGG + Intergenic
1076558721 10:131347062-131347084 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1076721960 10:132396807-132396829 CAGGCAGGGGAGCGGGGGGATGG + Intergenic
1077020588 11:415587-415609 CTGGGAGAGGGACGGGGAGAGGG - Intronic
1077915452 11:6608828-6608850 GAGGGAGAAGACAGGTGGGAAGG - Intronic
1078426288 11:11253769-11253791 CTGGGAGAAACACTGGGGGAAGG - Intergenic
1078434477 11:11313102-11313124 GAGGGATAAGAAAGGGGAGAAGG + Intronic
1078757529 11:14224915-14224937 CAGGGAGTAAAACGGGAGGCAGG + Intronic
1080396141 11:31891748-31891770 AAGGGAGAAGAGCGAGAGGAAGG + Intronic
1080458875 11:32436796-32436818 CAAGGAGAAGAACCGGGGGCCGG + Intergenic
1082016829 11:47495397-47495419 CATGGAGAAGAAGAGGGGAATGG + Intronic
1082717445 11:56632023-56632045 CAGGAAGAAGAATGGGGAGATGG + Intergenic
1082787409 11:57324582-57324604 GAGCCAGAAGAAAGGGGGGAGGG - Intronic
1082791574 11:57349602-57349624 CAGGGAAAGGAAAGAGGGGAGGG + Intronic
1082965726 11:58964587-58964609 CTGGGAGATGAACAGGGGTAGGG - Intronic
1082974588 11:59059437-59059459 CTGGGAGATGAATGGGGGTAGGG - Intergenic
1082979009 11:59103233-59103255 CTGGGAGATGAATGGGGGTAGGG - Intergenic
1083118703 11:60490858-60490880 CAGGGAGAGGGACAGGGAGAGGG - Intergenic
1083170997 11:60924119-60924141 CAGGGACAGGAAAGGAGGGAGGG - Intergenic
1083372400 11:62192644-62192666 CAGGGAGAAGAAGGCAGGGAGGG + Intronic
1083378288 11:62243881-62243903 CAGGGAGAGGAAGGCAGGGAGGG + Intronic
1083592930 11:63905745-63905767 CAGGGAGAGGAATGGCAGGATGG - Intronic
1083670194 11:64295675-64295697 CAGGGAGAAGACTAGGGGAAGGG + Intronic
1084045222 11:66564297-66564319 CAGGGAGAAGCCCTGGGGCAGGG + Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084092222 11:66886186-66886208 GAGGGAGAAGAGGGGAGGGAGGG + Intronic
1084569513 11:69950942-69950964 CAGGGAGAGGCACCGGGGGAAGG + Intergenic
1084581731 11:70028457-70028479 CAGGCAGTAGAACTGGGGGTGGG - Intergenic
1084658837 11:70535560-70535582 CAGACAGAAGGACGGGGAGATGG - Intronic
1084725680 11:70940221-70940243 GAGAGAGAAGAAGGGAGGGAGGG - Intronic
1084742735 11:71150002-71150024 AAGGGAGAGGAAGGGAGGGAGGG + Intronic
1084742741 11:71150020-71150042 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1084742747 11:71150038-71150060 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1084742753 11:71150056-71150078 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1084742836 11:71150269-71150291 GAGGGAGAGGAAGGGAGGGAGGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1085040530 11:73323959-73323981 CAGGGAGGAGAACAGGGAGAAGG - Intronic
1085521173 11:77139681-77139703 GAGGGAGAAGGAAGGGAGGAAGG - Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087990745 11:104743588-104743610 CGGGGAGAAGGAAGGAGGGAAGG + Intergenic
1088582741 11:111331348-111331370 AAGGGAGAAGAAGAGGGAGAGGG - Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088735615 11:112725480-112725502 CAGGGAGCAACATGGGGGGAGGG + Intergenic
1088792089 11:113235192-113235214 CAGGGAGAAGAAGGTGGGCTGGG - Intronic
1088911432 11:114195419-114195441 CAGGGAGCAGGAAAGGGGGATGG + Intronic
1089071164 11:115700700-115700722 CAGAGGGAAGAACGGGAGGAGGG + Intergenic
1089100091 11:115955715-115955737 TAGGGAGAAGGAGGAGGGGAAGG - Intergenic
1089286136 11:117409353-117409375 CAGAGAGAAGGAAGGGGAGAGGG - Intronic
1089289456 11:117428880-117428902 CAGAGAGAAGACTGGGGGCAGGG - Intronic
1089615833 11:119694243-119694265 CAGGGAGAAGAGGGGTGGGAAGG + Intronic
1090118551 11:124000647-124000669 TAGGTAGAATAACTGGGGGAAGG + Intergenic
1090268153 11:125367820-125367842 CAGAGAGAAGAAAGGGGAGGTGG - Intronic
1090344763 11:126061523-126061545 CAAGGAGAGGAAGGTGGGGAGGG - Intronic
1090416750 11:126545690-126545712 CAGGGAGAAGGAAGGGAGCAGGG + Intronic
1090471469 11:126984848-126984870 CAGGGAGGAGACCTGGAGGAGGG + Intronic
1090964462 11:131585869-131585891 CAGGGAGAAGAAAGGAAAGATGG - Intronic
1091113805 11:132995453-132995475 CAGAGGGAAGAAGGGAGGGAGGG - Intronic
1091765138 12:3115076-3115098 CAGGGAGAAAAACTGGGGGCAGG - Intronic
1091818901 12:3459700-3459722 CAGGGAGAAGGGCAGGGGGTTGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092239484 12:6828371-6828393 GAGGGAGAGGAAAGGGGGGAAGG - Intronic
1092735621 12:11579770-11579792 CTGGGAGAAGAAGGGTGGAATGG - Intergenic
1092923756 12:13255995-13256017 CAGGGAGGAGAAGGGGAGGGAGG + Intergenic
1093102625 12:15046322-15046344 AAGGGAAAAGAAGGGAGGGAAGG - Intergenic
1093110260 12:15143776-15143798 CAGGGAGAAGAAAGAGGAGTTGG + Intronic
1093315055 12:17639052-17639074 GAGGGAGAAGAGTGGGAGGAAGG - Intergenic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094232437 12:28122463-28122485 AAGAGAGAAGAAAGGAGGGAAGG + Intergenic
1094636702 12:32233509-32233531 AAGGGGGAAGAACGGGAGGGAGG - Intronic
1095774699 12:45999599-45999621 GAGGGAGAGGAAGAGGGGGAGGG - Intergenic
1096727475 12:53576305-53576327 CAGAGGGAAGAACAGAGGGAGGG - Intronic
1096753132 12:53775989-53776011 CAGGGAGTAGAAGGGAGGGAAGG + Intergenic
1096867035 12:54570750-54570772 CAGAGACCAGAACTGGGGGACGG - Intronic
1096883771 12:54696573-54696595 CAAGGAGAAGAAAGAGGGAAGGG - Intergenic
1097246903 12:57611830-57611852 CAGGGGGAATCACGGGGGGCGGG - Intronic
1097262472 12:57727329-57727351 GAGGGAACAGAGCGGGGGGAGGG - Intronic
1097285077 12:57870904-57870926 GAGGGAGAAGGAAAGGGGGAAGG - Intergenic
1098475903 12:70902729-70902751 CAGGGAGAAGAGTGGGAGGGGGG + Intronic
1099868405 12:88314955-88314977 GAGGGAGAAGAGTGGGAGGAGGG - Intergenic
1100043210 12:90345521-90345543 CAGGTAGAAGAATGAGGGCAGGG + Intergenic
1100176206 12:92033850-92033872 CAAGGAGAAGAAGGGAGAGAGGG + Intronic
1100184975 12:92129089-92129111 AAGGGAGAAGGAAGGGGCGATGG + Intronic
1100783582 12:98055431-98055453 CAGGGAGAAAAATGGAGAGAAGG + Intergenic
1101348153 12:103905238-103905260 GATGGAGGAGAAGGGGGGGAGGG + Intergenic
1101348217 12:103905426-103905448 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348265 12:103905556-103905578 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348278 12:103905606-103905628 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348304 12:103905673-103905695 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1102186551 12:110951909-110951931 GAGGGAGAGGGAGGGGGGGAGGG + Intergenic
1102227308 12:111237836-111237858 CAGGGGGAGAAACGGGGGCAGGG - Intronic
1102599889 12:114021694-114021716 CAGGGAGATGAGGGGAGGGAGGG + Intergenic
1102679672 12:114682958-114682980 CAGGGAGGAGAACGGGATGCCGG + Exonic
1102745232 12:115243968-115243990 GAGGGAGAAAAAGGGAGGGAGGG + Intergenic
1102745273 12:115244104-115244126 CAGGGAGAGGAAGGGAGAGAGGG + Intergenic
1102745279 12:115244122-115244144 GAGGGAGAGGAAGGGAGGGAAGG + Intergenic
1102969100 12:117152029-117152051 CAGTGGGAAGCACGGGGCGAGGG + Intronic
1102978761 12:117225348-117225370 CAGTGAGAAGAATTGGGGAATGG - Intronic
1103260606 12:119585218-119585240 AATGGAGAAGAATGGAGGGAGGG - Intergenic
1103586646 12:121961245-121961267 GGGGGAGAAGAAAGGAGGGAGGG - Intronic
1103899412 12:124295536-124295558 CAGGGAGTAGAAGGGCGGGCTGG - Intronic
1104125168 12:125839280-125839302 AAGGGAGAAGACTGGGTGGATGG + Intergenic
1104794412 12:131507172-131507194 CTGGGAGTAGAACAGAGGGAAGG + Intergenic
1105977008 13:25481193-25481215 CAGGGAGAGGAACAGGGACAGGG + Intronic
1106243082 13:27925456-27925478 GAGGGAGAAGAAGAGGAGGAGGG - Exonic
1106346815 13:28887312-28887334 CAGGGAGCCGAAAGGGGCGAGGG - Intronic
1106586135 13:31057908-31057930 GAGGGAGAAGAGGGCGGGGAGGG - Intergenic
1107018253 13:35726097-35726119 CCAGGAGAAGAACAGGGGGTGGG + Intergenic
1107199337 13:37695206-37695228 CAGGGAGAGGAAGGGAGTGAGGG - Intronic
1107394243 13:39998793-39998815 CAGGCAGAACAACTGGGAGAGGG - Intergenic
1108729510 13:53219975-53219997 CAGAAAGAAGAAAGGGGTGATGG + Intergenic
1110506553 13:76294679-76294701 GAGGGAGAAGGAGAGGGGGAGGG - Intergenic
1112060000 13:95729344-95729366 GAGGGAGAAGGATGGGGAGAAGG - Intronic
1112913955 13:104523043-104523065 CAGGGAGATGCACGGGGCAAAGG - Intergenic
1113098735 13:106694561-106694583 CAGGCAGAAGAAGGAAGGGAGGG - Intergenic
1113485492 13:110649654-110649676 GAGGGACAAGAAGGGGGAGAGGG + Intronic
1113613310 13:111663390-111663412 GAGGAAGAAGGACGAGGGGAAGG - Intronic
1113618503 13:111697402-111697424 CAGGGAGAGGAAGGGAGGCAGGG - Intergenic
1113624032 13:111782663-111782685 CAGGGAGAGGAAGGGAGGCAGGG - Intergenic
1114378701 14:22177360-22177382 CTGGGAGAAGACAGTGGGGAGGG + Intergenic
1114464364 14:22910509-22910531 AAGGGAGAAGGAGGGAGGGATGG + Intronic
1114860445 14:26511804-26511826 CAGGGAGACGAAGAGTGGGAGGG + Intronic
1115231471 14:31165411-31165433 CAGAGAGAAGAACTGGAGGAAGG - Intronic
1116035788 14:39625697-39625719 AAGAGAGAAGGACGTGGGGAAGG + Intergenic
1116273823 14:42805403-42805425 CAGGGAGAGGAAAGGGGAAAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116720557 14:48490271-48490293 CAGAGAGCAGAACGGTGTGATGG - Intergenic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1117595846 14:57326449-57326471 CAGGGAGAGGAAAAAGGGGAAGG - Intergenic
1117610958 14:57483020-57483042 CAGGGAGGTGAACTGGGGGTGGG - Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118495531 14:66304955-66304977 CACAGAGAAGAACTGGGGCAGGG + Intergenic
1118868988 14:69726122-69726144 CAAGGAGAAGAAAGGCGGGAAGG + Intergenic
1118892903 14:69924594-69924616 CAGGCAGAAGAATGTGGGGGAGG - Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119209999 14:72824397-72824419 CAGGGAGGAGAAGGGGGGAAAGG - Intronic
1119722204 14:76898885-76898907 CAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1119903622 14:78282372-78282394 GAGGGAGAAGCACTGGGGGAGGG - Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120928105 14:89818443-89818465 TAGGGAGAAGAAGGGAAGGAAGG + Intronic
1121325980 14:93019802-93019824 CAGGGGGATGCCCGGGGGGAAGG + Intronic
1121453285 14:94022980-94023002 CAGGGAGCAGAGCTGGGGGCTGG - Intergenic
1121586229 14:95064809-95064831 CAGAGAGAAGAAGGGAGGGGAGG + Intergenic
1122415211 14:101546264-101546286 CAGGGAGAAGAAGCGGGGGAAGG + Intergenic
1122873071 14:104650425-104650447 CAGGGAGAGGGAAGCGGGGATGG - Intergenic
1123009150 14:105338849-105338871 GAGGGAGAAGAGCGGGGAGATGG - Intronic
1123036773 14:105474815-105474837 CCCGGAGGAGAACGGGCGGAGGG + Intronic
1123470490 15:20548366-20548388 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123647569 15:22452334-22452356 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1123730789 15:23143344-23143366 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123748928 15:23340770-23340792 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124004651 15:25786063-25786085 CAGGGAGAAGTGTGGGGAGAAGG + Intronic
1124281300 15:28364653-28364675 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124301402 15:28546968-28546990 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1124599298 15:31118320-31118342 GAGGGAGAAGAAAGAGGGAAAGG + Intronic
1125038871 15:35160045-35160067 AAGGGAGAAGAAGTGGGGGAAGG + Intergenic
1126188467 15:45854068-45854090 TAGGGAGTGGAACGGGGGGGTGG - Intergenic
1126295189 15:47131724-47131746 GAGGGAGAGGGACAGGGGGAGGG - Intergenic
1126443869 15:48720204-48720226 CAGAGAGAAGATCTGGAGGAAGG + Intronic
1126465282 15:48956048-48956070 TAGAGAGAAGAACAGGGGAACGG + Intronic
1127226871 15:56940598-56940620 GAGGGAGAAGAAGGAGGAGAAGG - Intronic
1127446352 15:59067188-59067210 CAGGGAGAGAAATGGAGGGAGGG - Intronic
1128450968 15:67805636-67805658 GAGGGAGAAGAGCTGGGGGCAGG + Intronic
1128806929 15:70538145-70538167 CAGGGAGCAGGAGGTGGGGAGGG - Intergenic
1129870070 15:78934379-78934401 CCGGGAGAACAGCGGGGGCAGGG + Intronic
1129885021 15:79031624-79031646 GAGGGAGAGGAAGGGAGGGAGGG + Intronic
1129933049 15:79428256-79428278 GAGGGAGAAGAAAGGAAGGAGGG - Intergenic
1130025606 15:80268175-80268197 GATGGAGAAGAACGGGGTGCTGG + Intergenic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1130858138 15:87860204-87860226 GAGGGTGAAGAATGGGGTGATGG + Intronic
1132272996 15:100543498-100543520 GAGGGAGAGGAAGGGAGGGAAGG - Intronic
1132529729 16:440497-440519 CAGGTAGGAGAAAAGGGGGAAGG - Intronic
1132647264 16:1004862-1004884 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132647371 16:1005158-1005180 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1132859609 16:2063584-2063606 CAGGGAGGAGTTCGGTGGGAAGG - Intronic
1133485519 16:6215055-6215077 GAGGGAGAGGGACGGGGAGATGG + Intronic
1133666173 16:7970370-7970392 CAGAGGGAAGAAAGGAGGGAGGG - Intergenic
1133749503 16:8713576-8713598 AAGGGAGAGGGACGGAGGGAAGG - Exonic
1134010770 16:10851002-10851024 CAGGGAGAAGAAACGAGGAAAGG + Intergenic
1134019452 16:10911322-10911344 AAGGGGGAAGAAGGGAGGGAGGG - Intronic
1134912737 16:18042681-18042703 AAGGGAGAAGAAGGAGGAGAAGG - Intergenic
1135158636 16:20074291-20074313 TAGGGCAAAGAACGGGGGAAGGG + Intergenic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1136381505 16:29898184-29898206 CAGGGAGAAGGGAGAGGGGAGGG - Intronic
1136490623 16:30605415-30605437 CAGAAAGAAGAATGGGGAGAAGG - Exonic
1137662334 16:50219674-50219696 GAGGGAGAAGAAAAGGGGGAGGG - Intronic
1137709422 16:50555950-50555972 CAGGGAGAGGGTGGGGGGGAAGG - Intronic
1137746341 16:50822972-50822994 AAAGGAGAAGAATGGGGGTATGG + Intergenic
1137776678 16:51060747-51060769 AAGGGAGAAGGAGGGAGGGAGGG + Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1138010158 16:53371992-53372014 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138433174 16:56982360-56982382 CAGGGAGAGGAAAGGGGGCCAGG - Intronic
1138458809 16:57135966-57135988 AAGGGAGAAGGAGGGAGGGAAGG + Intronic
1139041498 16:63004455-63004477 CAGGGAGAGGAAGGGGGGTTTGG - Intergenic
1139352017 16:66342836-66342858 CAGGAAGAGGAACGGGGAGGTGG - Intergenic
1140223804 16:73063393-73063415 CAGGGAGTGGACCGGGGCGATGG - Intergenic
1140412036 16:74746954-74746976 CAGGGAGCAGAAGTGGGGGTTGG + Intronic
1140600696 16:76471641-76471663 CATGGAGAAGAGGGGAGGGAAGG - Intronic
1140713432 16:77699727-77699749 TAAGGAGAAGAAAGAGGGGAAGG + Intergenic
1140724422 16:77799254-77799276 GAGAGAGAAGAAGGAGGGGAGGG - Intronic
1141068298 16:80931883-80931905 AAAGGAGAAGAAGGAGGGGAGGG + Intergenic
1141775648 16:86121391-86121413 CAGGGAGAAGGAGGAGGAGAGGG - Intergenic
1141775658 16:86121422-86121444 CAGGGAGAAGGAGGAGGGAAGGG - Intergenic
1141878373 16:86841880-86841902 CAGGGAGGAGAATGGAGGCAGGG - Intergenic
1141970836 16:87481514-87481536 CAGGGAGAGAAACGGGGGGGGGG + Intronic
1142185525 16:88693143-88693165 CAGGGAGGAGGAAGGTGGGAAGG - Intergenic
1142236393 16:88924502-88924524 GGGGGAGAAGAGCGGGCGGAGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143091206 17:4450047-4450069 CAGGGAGGAGGCCGGGGTGAAGG - Intronic
1143113331 17:4566188-4566210 TAGGGAGAAGAATGGAGGGTAGG - Intergenic
1143373781 17:6455692-6455714 CAGGGGGAAGAAGGGAGGGGAGG + Intronic
1143628148 17:8122491-8122513 CAGGGGGAAGAAGGGAGGGACGG + Intronic
1143715852 17:8768538-8768560 AAGGGAGAAAAATGGGGGGGGGG - Intergenic
1143873637 17:9975549-9975571 GAGGAAGGAGAACGGGTGGAAGG - Intronic
1143887550 17:10076235-10076257 GAGGGAGAGGGACAGGGGGACGG + Intronic
1143953545 17:10652223-10652245 CAGGAAGAAGGAAGGTGGGAAGG - Intronic
1145047472 17:19628895-19628917 CAGGGAGAGGGACAGGGAGAGGG + Intergenic
1145262317 17:21361683-21361705 TATGGAGAAAAACAGGGGGAGGG - Intergenic
1145768981 17:27479020-27479042 GAGGGAGGAGCACGGAGGGAGGG - Intronic
1147930429 17:43977176-43977198 CAGGGAGAGGGAGGGGGAGAGGG + Intronic
1148051747 17:44772987-44773009 GAGAGAGAAGAATGGGAGGAGGG - Intronic
1148355393 17:46972259-46972281 CAGGGAGAAGATGGGATGGAAGG - Intronic
1148579640 17:48734680-48734702 GAGGGAGGAGAAAGGGAGGAAGG + Intergenic
1148765346 17:50035551-50035573 CAGGGAGGTGAGGGGGGGGAAGG + Intergenic
1148796566 17:50200052-50200074 AGGAAAGAAGAACGGGGGGAGGG - Intronic
1149278319 17:55071092-55071114 CAGGGAGAAGAAAAAGGAGATGG - Intronic
1149377108 17:56055210-56055232 AAGGGAGGAGAACGGGAGGTGGG - Intergenic
1149482941 17:57018144-57018166 CAGGGAGAAGACCGGCAGAAGGG - Intergenic
1149526802 17:57362690-57362712 GAGGGAAAAGAATGGGGGGAAGG - Intronic
1149612465 17:57967633-57967655 GAGGGAGAAGAATGGGGAGGGGG - Intergenic
1151189377 17:72387051-72387073 CAGGAAGGAGGATGGGGGGAGGG + Intergenic
1151361987 17:73594388-73594410 TAGGGAGCAGCACTGGGGGAGGG - Intronic
1151786061 17:76275692-76275714 CTGGGAGCCGAAGGGGGGGATGG - Intronic
1151828412 17:76536301-76536323 CAGGGAGAAGAAGCTGGAGATGG + Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152253423 17:79223684-79223706 AAGGGAGAAGAAAGAGGGGCCGG + Intronic
1152381246 17:79943326-79943348 CTGGGAGAGGAATGTGGGGAGGG + Intronic
1152432147 17:80254407-80254429 CAGTGAGAAGAAAGGGGTGGAGG - Intergenic
1152609313 17:81307818-81307840 CAGGAAGGAGAAAGGAGGGAAGG - Intergenic
1152802846 17:82339920-82339942 CACAGAGAAGCACTGGGGGAGGG - Intergenic
1153026489 18:677484-677506 CAGGGAGAGGAAGGGGTGAAAGG + Intronic
1153180947 18:2432315-2432337 CAGGGTGGAGAATGGTGGGAAGG + Intergenic
1153225759 18:2898418-2898440 CCGGGAGAGGAACAGTGGGAAGG - Intronic
1153924595 18:9824963-9824985 GAGGGAGAAGAGCGGCAGGAAGG - Intronic
1155019472 18:21882081-21882103 CAGCGAGAAGAACGCAGTGAAGG - Intergenic
1155684879 18:28536387-28536409 TAGGGAGAAGGAAGGGAGGATGG + Intergenic
1155823839 18:30413495-30413517 GAGGGAGGAGAAAGGGAGGATGG + Intergenic
1156406048 18:36783615-36783637 CAGGGGGAAGAACAGGGGCCAGG + Intronic
1156473966 18:37394267-37394289 CAGGGAGAGGGACGCGGGGCGGG + Intronic
1156805374 18:41172798-41172820 TAGGGAAAAGAATGGGAGGAGGG - Intergenic
1157690076 18:49674425-49674447 GAGGGAGAACAAGGGAGGGAGGG + Intergenic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1158710753 18:59835900-59835922 CAGGGAGCAGAATGCGGGGAAGG + Intergenic
1159468271 18:68813582-68813604 AGGGGAGAAGAAGGGAGGGAAGG + Intronic
1160049014 18:75414487-75414509 GAGGGAGGAGCACTGGGGGAAGG + Intronic
1160182038 18:76644894-76644916 CAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1160395328 18:78566727-78566749 CAGGGAGAAGGCCGGGGAGAAGG + Intergenic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160670863 19:362323-362345 CAGGGAGATGATCCGGGGGCTGG + Exonic
1161139620 19:2639768-2639790 AAGGGGGAAGAAGGGAGGGAAGG + Intronic
1161369928 19:3905362-3905384 CAGGTAGGAAAATGGGGGGAAGG + Intronic
1161404576 19:4084311-4084333 CAGGAAGAGGAGCGGAGGGAGGG + Intergenic
1161445899 19:4318959-4318981 AGGGGAGAAGAAAGGGGAGAGGG + Intronic
1161572864 19:5040003-5040025 CAGCGAGAAGTACGCGGGGCGGG + Exonic
1162301179 19:9846051-9846073 CAGGGAGAGGAGGGGTGGGAGGG + Intronic
1162343337 19:10105602-10105624 CAGGGGGAAGACGAGGGGGAGGG + Intergenic
1162660677 19:12166390-12166412 CAGGGAAAAGAAATGGGGGTGGG + Intronic
1162740608 19:12771512-12771534 TCAGGAGAAGGACGGGGGGAGGG + Intronic
1162846059 19:13393559-13393581 GAAGAAGAAGAAGGGGGGGAGGG - Intronic
1163598374 19:18233415-18233437 AGGGGAGAAGAACGTGGTGAGGG + Intronic
1164292351 19:23879814-23879836 GAGGAAGAAGAAGGAGGGGAAGG + Intergenic
1164393743 19:27846423-27846445 CCGGGGGAAGAATGGAGGGAAGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164793030 19:31004001-31004023 TAGGGAGAAGAAAGGTGGGGTGG + Intergenic
1164834618 19:31349461-31349483 GAGGGAGGAGCACGGGGGGGAGG + Exonic
1164868703 19:31625866-31625888 GAGGAAGAAGAAAAGGGGGATGG - Intergenic
1165115044 19:33523480-33523502 CAGGAAGAAGAACAGAGGTAAGG + Intergenic
1165328354 19:35126825-35126847 CAGGCAGAAGGACGGGGAGGGGG + Intronic
1165825556 19:38703774-38703796 CAGGGAGAGGAACTGGGTGGCGG + Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1167109086 19:47448247-47448269 GAGGGGGAAGAGCGGGGTGAGGG + Intronic
1167140609 19:47648102-47648124 CAGAGAGAGGGACGGGGAGACGG - Intronic
1167381795 19:49142585-49142607 TAGGGAGAGAAACGGGGGGCGGG - Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1168296340 19:55378880-55378902 CAGGGAGAGGGAGGGAGGGATGG - Intergenic
925233052 2:2252818-2252840 AAGGGGGAAGAAAGAGGGGAAGG - Intronic
925948361 2:8887645-8887667 CAAGGAGAAGAGGTGGGGGAAGG + Intronic
925991850 2:9260644-9260666 AAGGGAGAAGAAAGGCAGGAAGG - Intronic
928009664 2:27595132-27595154 GAGGGAGGAGAGCGGGGAGAGGG + Intronic
928143102 2:28747882-28747904 CAGTGAGCAGGATGGGGGGAGGG + Intergenic
928376120 2:30776172-30776194 GAGAGAGGAGAACCGGGGGAGGG + Intronic
928747607 2:34433708-34433730 AAGGGAGAAGAAGGGAGAGAAGG - Intergenic
929008670 2:37419709-37419731 CAGGGAGAAGACTGAGGGGTAGG + Intergenic
929018535 2:37526687-37526709 CTGGGAGATGAACAGGGAGACGG + Intergenic
929444503 2:41991951-41991973 GAGGGAGAAGAGGAGGGGGAGGG + Intergenic
929453934 2:42053459-42053481 CAGGGAGAGGGAGGGGAGGAAGG + Intronic
929739344 2:44587450-44587472 GAGGGAGAGGGACAGGGGGAGGG - Intronic
930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG + Intergenic
930975699 2:57457890-57457912 CAGTTGGAAGAACGGGGGTACGG + Intergenic
931308712 2:61057883-61057905 CAGGGAGAAGAGAGGGGGTTTGG - Intergenic
931348887 2:61470955-61470977 GGGGGGGAAGGACGGGGGGAGGG + Intergenic
932491756 2:72127232-72127254 GAGGGAGAAGAGAGGGGGAAAGG - Intergenic
932598845 2:73110859-73110881 GAGGGTGAAGGACTGGGGGAAGG + Intronic
933280374 2:80326470-80326492 CAGGGAGAGGCAAGGGGGGCAGG - Intronic
933750767 2:85601121-85601143 CAGGGAGTAGACTGGGGGAAGGG + Intronic
933868654 2:86546360-86546382 AAGGGAGGGGAAGGGGGGGAGGG + Intronic
934851914 2:97707102-97707124 AAGGTAGAGGAATGGGGGGAGGG + Intergenic
935046774 2:99489913-99489935 CAGGGAGGAGGGCCGGGGGAAGG + Exonic
935501533 2:103846776-103846798 GAGGGAGAAGAAAGGGAGAATGG + Intergenic
936611505 2:114006271-114006293 CAGGGGGAAAAAGGGTGGGAAGG + Intergenic
937703565 2:124891948-124891970 CAGGGAGAAGAAAGCAGGGACGG - Intronic
937735023 2:125277782-125277804 CAGGGAGAGGGAGAGGGGGAGGG + Intergenic
937878543 2:126847240-126847262 CAGGGAGAGGGAGGGGAGGATGG + Intergenic
938085261 2:128395811-128395833 CTGGGAGAAACACGTGGGGATGG - Intergenic
938122670 2:128644853-128644875 CAGGGAGGAGGAAGGGAGGAGGG - Intergenic
938515584 2:132002684-132002706 GAGGGAGAGGAAGGGAGGGAGGG - Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
938934403 2:136116381-136116403 AAGGGAGGATCACGGGGGGAGGG + Intronic
939629768 2:144517203-144517225 CAGGGAGAAGGAGGGGGAAAGGG - Intronic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941548938 2:166889851-166889873 CAAGGAGAAGAAGGTGGAGATGG - Intronic
941677016 2:168354922-168354944 CAGGAAGAAGAATTGGGAGAAGG + Intergenic
943821644 2:192330509-192330531 AAGGGGGAAGAAAGGAGGGAAGG + Intergenic
944969427 2:204975433-204975455 CAGGGAGAAGGATGGATGGATGG - Intronic
945744522 2:213704043-213704065 CAGCCAGAAGAACAAGGGGATGG - Intronic
945929550 2:215841526-215841548 CAGGAAGGAGAAGGGAGGGAGGG - Intergenic
946161789 2:217840036-217840058 GAGGAAGAAGAAAGGAGGGAGGG + Intronic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
947035495 2:225849250-225849272 GAGGGAGAAAAATGGGGGAACGG + Intergenic
947235005 2:227932050-227932072 CAAGGAGAAGAAGGTGGGGGCGG - Intergenic
947661201 2:231869972-231869994 GAGGGAAAAGGAAGGGGGGAGGG - Intergenic
947731297 2:232433042-232433064 CAGGGAGCAGACCAGGGGAAAGG + Intergenic
948530170 2:238599167-238599189 CAGGGAGGAGAAGGGAGAGAGGG + Intergenic
948797412 2:240412072-240412094 GGGGAAGGAGAACGGGGGGAGGG - Intergenic
1170954256 20:20964011-20964033 AAGGTAGAAGAATGGGGGGATGG + Intergenic
1171258074 20:23706668-23706690 CATGGAGAAGAAGTGAGGGAAGG - Intergenic
1171265554 20:23769280-23769302 CATGGAGAAGAAGTGAGGGAAGG - Intergenic
1171275290 20:23851699-23851721 CATGGAGAAGAAGTGAGGGAAGG - Intergenic
1171966770 20:31536450-31536472 CAGGGAGCAGGAGAGGGGGACGG - Intronic
1172045882 20:32079888-32079910 CAGGGAGGACAAGGTGGGGAGGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172301540 20:33853735-33853757 CTGGGAGATGGGCGGGGGGAGGG + Exonic
1173201958 20:40960975-40960997 GAGGGGGAAGAAAAGGGGGAGGG + Intergenic
1173339145 20:42138268-42138290 CAGGCAGAAGATTGGGTGGAGGG + Intronic
1173427490 20:42955803-42955825 GAGGGAGAAGGAGGGAGGGAGGG + Intronic
1173427499 20:42955829-42955851 GAGGGAGAAGGAGGGAGGGAGGG + Intronic
1173427506 20:42955847-42955869 GAGGGAGAAGGAGGGAGGGAGGG + Intronic
1173440043 20:43067963-43067985 AAGGGAGAGGAAGGGAGGGAAGG + Intronic
1173757645 20:45532067-45532089 AAGGGAGAAGAAAGGGGTGAAGG - Intergenic
1174079863 20:47963012-47963034 CAGGGAGTAGGAGGGGGGCAAGG - Intergenic
1174264582 20:49322141-49322163 CAGCTAGAAGCACTGGGGGATGG + Intergenic
1174292613 20:49519703-49519725 CAGGGAGAAGATCGGGGGTTGGG - Intronic
1174495555 20:50939163-50939185 CAGGGAGAGGAATGGGGTGAGGG - Intronic
1174940070 20:54917126-54917148 CAGGAAGAAGAAGGGGGAGCAGG + Intergenic
1175304159 20:57964609-57964631 CACGAAGAAGAAAGGGGAGAAGG + Intergenic
1175531978 20:59680080-59680102 CAGGAAGAAGGAAGGAGGGAGGG - Intronic
1175753070 20:61512571-61512593 GAGGGAGATGAATGGGGCGAGGG + Intronic
1175763133 20:61574488-61574510 CAGGAAGGAGAAAGGGGGGTGGG - Intronic
1175928210 20:62481088-62481110 CAGGGTGGAGACTGGGGGGAGGG - Intergenic
1176266732 20:64213174-64213196 AAGGGAGAGGAAGGGGGTGAGGG + Intronic
1177975820 21:27849254-27849276 GAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1178484619 21:33010828-33010850 CATGGAGAAGAGGGGAGGGATGG - Intergenic
1179062688 21:37994329-37994351 CTGGGACCAGAACGGGGAGAAGG + Intronic
1179482002 21:41684462-41684484 GAGGGAGAGAAACGGGAGGAGGG + Intergenic
1180013084 21:45064247-45064269 GAGGAAGAAGAAGGGTGGGAGGG - Intergenic
1180673977 22:17574414-17574436 CAGGGAACAGAACTGTGGGAAGG - Intronic
1181518728 22:23433353-23433375 CAGGGAGAGGAAAGGCGGCAAGG - Intergenic
1181811392 22:25405546-25405568 CAGGGCGAGGAGCGCGGGGAGGG - Intergenic
1182027992 22:27135389-27135411 GAGTGAGAAGAAGGGGGAGAGGG + Intergenic
1182166384 22:28178466-28178488 GAGGGAGAGGAACGGGGGAGGGG + Intronic
1182481971 22:30615006-30615028 TAGGGAGAAGGACTGGAGGAGGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183064886 22:35355990-35356012 CAGAGACAAGAACGGGGAAAGGG + Intergenic
1183086966 22:35492303-35492325 CAGGGAGCACACCTGGGGGAGGG - Intergenic
1183192308 22:36329480-36329502 CAGGGAGACGCAGTGGGGGAGGG - Intronic
1183977319 22:41520131-41520153 CAAGGAGAAGAAAGAGAGGAGGG - Intronic
1184177373 22:42795900-42795922 CAGGGGGGAGACCGAGGGGAAGG + Intergenic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184425496 22:44406855-44406877 CAGGCAGAGGAATGGGTGGAGGG - Intergenic
1184550322 22:45200953-45200975 CCAGGTGAAGAAGGGGGGGAAGG + Intronic
1184555473 22:45230403-45230425 CAGGGAGAAGGGCAGAGGGAGGG - Intronic
1184656125 22:45943158-45943180 GAGGGAGAAACAGGGGGGGAAGG - Intronic
1185037723 22:48488749-48488771 CAGGGAGATGAACCAGGAGATGG + Intergenic
1185270358 22:49926836-49926858 GAGGGAGGAGAATGAGGGGACGG - Intronic
1185406722 22:50656380-50656402 CAGAGGGCAGAACGGGGTGAAGG + Intergenic
949379988 3:3433641-3433663 GAGGGAGAAGAAAGGAGGGATGG + Intergenic
949432421 3:3991861-3991883 GAGAGAGAAGGACGGAGGGAAGG + Intronic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
950360826 3:12448367-12448389 GAGGGAGAAGAAGGGAAGGAAGG + Intergenic
950360836 3:12448407-12448429 GAGGGAGAAGAAGGGAAGGAAGG + Intergenic
950360865 3:12448539-12448561 GAGGGAGAAGAAGGGAAGGAAGG + Intergenic
950360880 3:12448599-12448621 GAGGGAGAAGAAGGGAAGGAAGG + Intergenic
950360909 3:12448731-12448753 GAGGGAGAAGAAGGGAAGGAAGG + Intergenic
950478882 3:13232497-13232519 CAGGGAGAAGAAAGGCGGGGAGG + Intergenic
950506877 3:13400476-13400498 CAGGGAGGATAACAGGAGGAAGG + Intronic
950943000 3:16912974-16912996 AAGGGAGAAGAACAGAAGGAAGG - Intronic
951269539 3:20607941-20607963 CAGGGGGTAAAACAGGGGGAAGG + Intergenic
951558581 3:23945113-23945135 CAAGGAGAAGGAAGGGGAGAAGG + Intronic
952007927 3:28863807-28863829 GAGGGAGAAGAATGATGGGATGG + Intergenic
952033262 3:29170201-29170223 GAGAGAGAGGAAGGGGGGGAAGG + Intergenic
952255638 3:31693106-31693128 CAGGGAGAAGAACAGCTGGAGGG + Intronic
952478727 3:33737595-33737617 CAGGGAAAAGAAGAGGGGAAAGG - Intergenic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
952719096 3:36513838-36513860 GAGGGAGCAAAAGGGGGGGAGGG + Intronic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
956690916 3:71876995-71877017 CAGGGAGGAGACTGGAGGGATGG + Intergenic
958811518 3:98865431-98865453 CAGAGAGTAGAACGGGTTGAAGG + Intronic
959357810 3:105354354-105354376 AAGGGAGAAGAACGGAGGAGAGG - Intergenic
959416258 3:106079043-106079065 GAAGGAGAAGAAGGGAGGGAGGG - Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
960625371 3:119677040-119677062 CAGGGAGGAGGAGTGGGGGAAGG + Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961041873 3:123683444-123683466 CAGGGAGCAGAACTGGGGGCTGG + Intronic
961191326 3:124964602-124964624 CAGAGAGTAGAACGGTGGGAGGG + Intergenic
961328293 3:126124514-126124536 CTGGGAGAGGAAGGCGGGGAGGG - Intronic
961427176 3:126857457-126857479 CAGGGAGTACAATGGGGGAAAGG - Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962418000 3:135201311-135201333 CAAGGAGAAGAATGGGGGATGGG + Intronic
962520871 3:136196351-136196373 AAGGGAGAGGAAAGGGGGGAGGG - Intronic
962910758 3:139847496-139847518 GAGGGAGAAGAAGGGGGAGTAGG + Intergenic
965583004 3:170289471-170289493 CAGGGACAAGAATGGAAGGAAGG + Intronic
965720940 3:171661601-171661623 CAGGGAAAAGAACGTGGAAAAGG - Intronic
965772189 3:172193120-172193142 CAGGGAAAGGAAGGGAGGGAGGG - Intronic
966181983 3:177196906-177196928 GAGAGAGGAAAACGGGGGGATGG + Intronic
966588197 3:181650937-181650959 AAGAGAGAAGAAGGGAGGGAAGG + Intergenic
967049565 3:185770112-185770134 AAGGAAGCAGAACTGGGGGATGG + Intronic
967815520 3:193795240-193795262 CAGGGAAAGGCACGGGAGGAGGG + Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968275940 3:197440210-197440232 CTTGGGGAAGAACAGGGGGACGG + Intergenic
968937254 4:3617652-3617674 AAGGGAGGAGAAGGGAGGGATGG - Intergenic
970018840 4:11543917-11543939 CAGGGAAAACAACCAGGGGAAGG - Intergenic
970781576 4:19744164-19744186 GAGGGAGAAGAAGGGATGGAAGG - Intergenic
971219925 4:24695722-24695744 CTGGGAGAAGAAGGAGGGGGTGG + Intergenic
971365298 4:25972229-25972251 CAAGGAGAAGAAAGGTGGGTGGG + Intergenic
971703200 4:30007259-30007281 CAGGGAGGAGAGTGGGAGGAGGG + Intergenic
973779108 4:54271846-54271868 AAGGGAGAACAAGGGAGGGAGGG - Intronic
974047360 4:56908640-56908662 CAGGGAGAGGCCCTGGGGGAGGG - Intronic
974909897 4:68104499-68104521 CAGGGAGAAGTACAGCGTGAAGG - Intronic
975233467 4:71962635-71962657 CAGGTGGAAGAATGGGGTGAGGG - Intergenic
975360254 4:73461012-73461034 GGGGGAGAAGAAGGGGGAGAAGG - Intergenic
975563726 4:75732162-75732184 TGGGGACAACAACGGGGGGAAGG - Intronic
976100587 4:81558570-81558592 CCAGGTGAAGAACGGGGTGAGGG + Intronic
976830933 4:89312999-89313021 GAGAGAGAAGAAGGGGAGGAAGG - Intergenic
976854684 4:89589937-89589959 CAGGGATAAGCACTGGGGCAAGG - Intergenic
977755451 4:100666492-100666514 CATGTAGAAGGATGGGGGGAGGG - Intronic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
978431500 4:108637399-108637421 CAGGGAGAAGGAATAGGGGAGGG + Intergenic
978811067 4:112850353-112850375 CAGAGAGATGAATGGGTGGATGG - Intronic
980113635 4:128658693-128658715 CAGGGAGAAGGAAAAGGGGAAGG + Intergenic
980548344 4:134299629-134299651 CAGGGGGAAGAAGAGGGGGTTGG - Intergenic
981081102 4:140640271-140640293 CAGGGGGAAGAAAGGGGAAAGGG + Intronic
981107863 4:140901874-140901896 GAGGGAGAAGCATGGGAGGACGG + Intronic
981325079 4:143436948-143436970 CAGGGAGAGAGACGGGAGGAAGG + Intronic
983649057 4:170020627-170020649 CAGGGAGGGGAATGGGAGGAGGG - Intronic
984703992 4:182834606-182834628 AGGGGAGAAGAAGGAGGGGAGGG - Intergenic
984775507 4:183478249-183478271 GAGGGAAAAGAAAGGAGGGAAGG - Intergenic
985140991 4:186840559-186840581 GAGGGAGGAGAAGGAGGGGAAGG - Intergenic
985508415 5:298440-298462 CAGTGGGAAGAAGGAGGGGACGG + Intronic
985739631 5:1607228-1607250 CAGTGGGAAGAAGGAGGGGACGG - Intergenic
985781387 5:1873710-1873732 CAGAGGGAAGAAGTGGGGGAGGG - Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986667540 5:10116575-10116597 GAGAGAGAAGAAGGGAGGGAGGG + Intergenic
986928028 5:12782599-12782621 GAGGGAGAAGAAGAGGGTGAAGG + Intergenic
987116091 5:14728113-14728135 CAGAGAGAAGTGCGGAGGGAAGG + Intronic
987191901 5:15487113-15487135 GAGGGATAAGAACGTGGAGAGGG + Intergenic
987264173 5:16235188-16235210 CAAGGAGGAGAAAGGGGAGATGG - Intergenic
987355596 5:17060928-17060950 CAGTGAGGAGAAAGGTGGGATGG + Intergenic
987390957 5:17375225-17375247 GAGGGAGAGGAAGGGAGGGAGGG - Intergenic
987775783 5:22363996-22364018 GAGGGAGGAGAATGAGGGGAGGG - Intronic
988280092 5:29134262-29134284 CAGGGAGGGCAAGGGGGGGATGG + Intergenic
988299770 5:29406789-29406811 GAGGGAGAAGAAATGGGGAAAGG + Intergenic
988731309 5:33975880-33975902 CAGGGAGAAGGAAGGGGGAATGG - Intronic
988895256 5:35665425-35665447 GAGGGAGAGGAACAGAGGGAGGG + Intronic
989331394 5:40263178-40263200 GAGAGAGAAGAAGGGAGGGAGGG + Intergenic
990308301 5:54515335-54515357 GAAGGAGAAGAAAGGAGGGATGG + Intergenic
991101456 5:62797964-62797986 GAGGGAGAAGAATGAGGAGAAGG - Intergenic
991249152 5:64540794-64540816 CAGGCAGAAGAAAGGAGGGAGGG + Intronic
991252915 5:64583493-64583515 GAGGGAGAAGAAAGAGAGGAGGG + Intronic
991444748 5:66687218-66687240 GAGGGAAAAGAAGGGGGTGAAGG - Intronic
993275983 5:85859312-85859334 GAGGGAGAAAAATGGGGGAATGG + Intergenic
993689118 5:90977258-90977280 GAGGGAGGAGAACTGGGGCAAGG + Intronic
994302569 5:98163084-98163106 CAGGGTGGAGAACAGGGAGATGG + Intergenic
994681145 5:102889136-102889158 CAGGCTGAAGAAGGGTGGGAAGG - Intronic
994852769 5:105076940-105076962 CAGGAAGGAGAACGGGTGGAGGG + Intergenic
995180850 5:109228907-109228929 CGGGGAGAGGAAAGGGGAGAGGG + Intergenic
995270937 5:110219415-110219437 TAGGGACAAGAACGGGGAGATGG + Intergenic
997005491 5:129812088-129812110 CACGGAGAAGGAAGGGTGGAAGG - Intergenic
997294206 5:132759767-132759789 CAGGGAGAAGCAGGGATGGATGG + Intronic
997448553 5:133962445-133962467 TAGGGAGAAGAACGGGAGAATGG - Intronic
997699433 5:135886301-135886323 CATGGAGGAGGGCGGGGGGAGGG - Intronic
998103649 5:139454929-139454951 CAGAGAAAAGAATGGGGTGAAGG + Intronic
998258168 5:140606086-140606108 GAAGGAAAAGAAGGGGGGGAAGG - Intergenic
998465665 5:142341864-142341886 GAGGGAAAAGAAGGGGGAGAAGG + Intergenic
998512825 5:142727941-142727963 GAGGGAGAAGAAAGGAGGGCTGG + Intergenic
998561510 5:143176488-143176510 CAGGAAGAAGAACCAGAGGAGGG - Intronic
998984742 5:147743955-147743977 GAGGGAGAAGGAGGGAGGGAGGG - Intronic
999189120 5:149733098-149733120 AAGGGAGATGAAGGAGGGGAGGG - Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999678937 5:154037224-154037246 CAGAGAGAAGAACAATGGGAAGG + Intronic
1000974984 5:167754892-167754914 AAGGGAGCAGAAAGGGAGGAGGG + Intronic
1001452157 5:171835222-171835244 CAGGGAGAGGATGGGCGGGATGG + Intergenic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1002140010 5:177132793-177132815 GAGGGAGAGGGATGGGGGGAGGG + Intergenic
1002377005 5:178796045-178796067 AAGGGAGAGGAAAGGAGGGAGGG + Intergenic
1002398008 5:178972774-178972796 CAGGGGGAAGATGTGGGGGAAGG + Intergenic
1002522975 5:179801518-179801540 CAGGGAGGAGCACGGGGTGGGGG - Intronic
1003330595 6:5125289-5125311 GAGGGAGGAGAGCTGGGGGAGGG - Intronic
1003380138 6:5617476-5617498 GAGGCAGAAGGACGGGGGCAGGG - Intronic
1004100046 6:12600196-12600218 GAGGGAGGAGAAGGGGAGGAAGG + Intergenic
1004336314 6:14767694-14767716 CACAGAGAAGTACGGGGTGAAGG + Intergenic
1004411600 6:15386248-15386270 GGGGGAGAAGAACAGGGAGAGGG - Intronic
1004528795 6:16434869-16434891 CAAAGAAAAGAACGGGGTGATGG + Intronic
1005365474 6:25071877-25071899 CAGGGAGAAGAAAGACAGGAAGG - Intergenic
1005665103 6:28044441-28044463 AAGGAAGAAAAAAGGGGGGAGGG + Intergenic
1006176570 6:32125992-32126014 CAGGGAGAAAAAGGTGGGGAGGG - Intronic
1006191136 6:32210276-32210298 CAGAGAGTAGAAGGGTGGGATGG + Intronic
1006376998 6:33677156-33677178 CAGGGAGAGGCACAGGGGGCCGG - Intronic
1006403143 6:33829508-33829530 CAGGGAGGTGAAGGAGGGGAGGG - Intergenic
1006824062 6:36921209-36921231 CTGGGAGAAGAATGGGGGCAGGG + Intronic
1006959219 6:37910722-37910744 CAGAGAGTAGAATGGGGGGTTGG - Intronic
1006975931 6:38101371-38101393 CAGGGAGAAGAAAAGGTGTAAGG + Intronic
1007037152 6:38686138-38686160 TGGGGAGAAGAACTTGGGGAGGG + Intronic
1007073196 6:39050855-39050877 CAGGGAAGAGAAAGGGGTGAAGG + Intronic
1007116396 6:39346097-39346119 GAGGGAGAGGGAGGGGGGGAGGG - Intronic
1007262270 6:40572049-40572071 GTGGGAGCAGAACGGGAGGAGGG - Intronic
1007280302 6:40707349-40707371 CAGAAAGAAGGACGGAGGGAGGG + Intergenic
1007398613 6:41591134-41591156 AAGGGAGAGGTACTGGGGGAGGG + Intronic
1007419419 6:41710779-41710801 GTGGGAGAGGAACTGGGGGAGGG - Intronic
1007554970 6:42758153-42758175 CAGGGAGAAGAAGATGAGGAAGG - Intronic
1007662980 6:43497760-43497782 CAGGGAGAACCACGGCAGGAAGG - Intronic
1007837193 6:44682683-44682705 CAGAGAGAGGAAAGGAGGGAAGG - Intergenic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1008008968 6:46443531-46443553 CAAGGAGAAGAAAAGGGAGATGG - Intronic
1008042471 6:46816572-46816594 GAGGAAGAAGAAGGGGAGGAGGG + Intronic
1008514636 6:52307456-52307478 CAGGGAGAGAAACGGGGAGGAGG - Intergenic
1009594972 6:65723668-65723690 CAAGGACAACAACGGGGAGATGG - Intergenic
1011160284 6:84381894-84381916 CAGGGGGAAGAACGGTGAGGGGG - Intergenic
1011409685 6:87055082-87055104 CAGGGAGGAGAATGGGCAGAGGG - Intergenic
1012210368 6:96510853-96510875 CAGGGGGAAGAAAGAGGGAAAGG - Intergenic
1012245251 6:96919025-96919047 CAGGGAGAAGAGAGGTGGGGAGG - Intergenic
1012840526 6:104323874-104323896 GAGGGTAAAGAACGGGAGGAGGG + Intergenic
1013067805 6:106700453-106700475 AAGGGAGAAGGGCGAGGGGAAGG - Intergenic
1013227968 6:108134189-108134211 CAGGGAGAGGGGCGCGGGGAGGG - Intronic
1013360896 6:109393187-109393209 CAGGGAGAAAAACAGAGGGGAGG - Intronic
1013585386 6:111573850-111573872 GATGGAGAAGAAAGGGGGGCTGG + Intronic
1013619008 6:111871742-111871764 CAGGGGAAAGAACGAGGGGATGG + Intronic
1013744864 6:113333727-113333749 CAGTGAGGAGAATGGGTGGACGG + Intergenic
1013751394 6:113410794-113410816 AAGGGAGAAGAAGGAAGGGAGGG + Intergenic
1015385708 6:132620626-132620648 CGGGGAGGAGGACGGGAGGAGGG + Intronic
1016073808 6:139772663-139772685 GAGGGAGAAGGAAGGAGGGAGGG - Intergenic
1017024340 6:150168111-150168133 TAGGGAGAAGGAGTGGGGGAGGG - Intronic
1017188191 6:151623787-151623809 CAGGGAGAGGCAAGGAGGGAAGG - Intergenic
1018132134 6:160741803-160741825 GAGGGAGAAGAGTGGGAGGAGGG - Intronic
1018298640 6:162376808-162376830 GAAGGAGAAGAACAGGGAGAGGG + Intronic
1018637890 6:165880637-165880659 GAGGCAGAAGAACATGGGGATGG - Intronic
1018762262 6:166902790-166902812 CAGGGAGAAGAGTGTGGAGAAGG - Intronic
1019018356 6:168896803-168896825 GAGGGAGAAGGACTGGGGGAAGG - Intergenic
1019402970 7:866777-866799 CAGGGAGAAGGGGGCGGGGAGGG - Intronic
1019551738 7:1606672-1606694 GAGGGGGAAGAAGAGGGGGAAGG - Intergenic
1019599831 7:1875590-1875612 CAGGGAGAGGAAAGGCGGCAAGG + Intronic
1019932111 7:4230469-4230491 CAGGGGGAAGGAAGGAGGGAGGG + Intronic
1020797798 7:12697615-12697637 CAGGGGGAAGCAAGTGGGGAAGG - Intergenic
1021839803 7:24713365-24713387 CAGGGAGAAGGGTGAGGGGAAGG + Intronic
1021958226 7:25847753-25847775 CAGGGAGAAGAAGGGGTAGAGGG - Intergenic
1021983505 7:26077532-26077554 CAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1022000839 7:26224641-26224663 CAGAGAGTAGAATGGGGGTAAGG + Intergenic
1022675432 7:32495327-32495349 CGGGGGGAGGAGCGGGGGGAGGG - Intergenic
1022750905 7:33224605-33224627 TAGGGAGAAGATCGGTGGGGAGG - Intronic
1023060176 7:36319174-36319196 AAGGGAGAAGAGCGGGAGAAGGG + Intergenic
1023452769 7:40305059-40305081 CAGGGTGAAGAAAGGAGGAAAGG - Intronic
1023969042 7:44978233-44978255 CAGGGAGAAGCCCGGGAGGTAGG - Intronic
1024746602 7:52414029-52414051 CAAGGAGAGGAAGGGAGGGAGGG + Intergenic
1025120867 7:56300800-56300822 GTGGGAGAAGAAAGGAGGGAGGG + Intergenic
1025147358 7:56516317-56516339 CTGGGAGAAGTAGGTGGGGAGGG + Intergenic
1025198843 7:56949844-56949866 TAGGGAGGAGAAAGGGAGGAGGG - Intergenic
1025673103 7:63627089-63627111 TAGGGAGGAGAAAGGGAGGAGGG + Intergenic
1026747961 7:73027432-73027454 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026751609 7:73055571-73055593 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026755258 7:73083686-73083708 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026758908 7:73111718-73111740 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026833039 7:73621845-73621867 GAGGGAGAAGGAGGGAGGGAGGG - Intronic
1027034165 7:74912722-74912744 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1027088498 7:75281767-75281789 CAGGAAGGAGAACCTGGGGAGGG + Intergenic
1027092141 7:75309695-75309717 CAGGAAGGAGAACCTGGGGAGGG + Intergenic
1027095784 7:75337662-75337684 CAGGAAGGAGAACCTGGGGAGGG + Intergenic
1027323556 7:77030032-77030054 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1027485558 7:78757281-78757303 GAGGGAGAAGGAGGGAGGGAGGG - Intronic
1027540668 7:79460191-79460213 CATGGAGAGGAAAGGGAGGAAGG + Intergenic
1027936453 7:84610175-84610197 CACAGAGAAGAACTAGGGGAAGG - Intergenic
1028232411 7:88321092-88321114 CCTGGAGAAGAACGGGTGTAGGG - Intergenic
1028502759 7:91537410-91537432 GAGGGAGAAGAAGTGGGGGCGGG - Intergenic
1029177045 7:98672120-98672142 CAGAGAGAAGATGGTGGGGATGG + Intergenic
1029395884 7:100308379-100308401 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396106 7:100309765-100309787 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396331 7:100311155-100311177 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396556 7:100312545-100312567 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396781 7:100313938-100313960 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029905120 7:104084577-104084599 CAGGGGGAAGGATGGGAGGAGGG + Intergenic
1029996662 7:105013738-105013760 GGGGGAGAGGAACGGGGAGACGG + Intergenic
1030128295 7:106176161-106176183 AAGGGAGGAGAACAGAGGGAGGG - Intergenic
1030759734 7:113335609-113335631 TAGGGAGAAAAGCGGGGGTATGG + Intergenic
1031116851 7:117678195-117678217 CAGGGACAAGAACGGTAGGCTGG + Intronic
1031419214 7:121529629-121529651 AAGGGAGAAGAAGAGAGGGAGGG - Intergenic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031529235 7:122856034-122856056 CAGGCAGAAGGAAGGGGGAAGGG - Intronic
1031586000 7:123532990-123533012 CAGGAGGAAGAAAGGGGGGTTGG + Intronic
1031601158 7:123712036-123712058 CAGGCAGAAGGACAGTGGGAGGG - Intronic
1031916085 7:127564298-127564320 CTGGAAGAAGATCTGGGGGAAGG - Intergenic
1031990202 7:128192646-128192668 CAAGGGGAAGAAGAGGGGGATGG - Intergenic
1032011634 7:128351418-128351440 CAGGGAGAGGAAGCCGGGGACGG + Exonic
1033801670 7:144909180-144909202 CAGGGAGCAGCAGGTGGGGAAGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033969867 7:147025506-147025528 CGGGGAGAAGAAAGTGGGGAGGG + Intronic
1034004368 7:147452938-147452960 GAGGGAGAAGAAAGGGAGGGAGG + Intronic
1034252896 7:149706554-149706576 GAGGGAGAGAAAGGGGGGGAAGG - Intergenic
1034500336 7:151446708-151446730 CATGGAGAAGGAAGTGGGGAAGG - Intergenic
1035784303 8:2249348-2249370 CAGGAGGAGGAACGAGGGGAAGG + Intergenic
1035784314 8:2249386-2249408 CAGGAAGAGGAACCAGGGGAAGG + Intergenic
1035808345 8:2471833-2471855 CAGGAAGAGGAACCAGGGGAAGG - Intergenic
1036123609 8:6043930-6043952 CAGAGATAAGAAGGGGGAGAGGG - Intergenic
1036213337 8:6860247-6860269 CAGGGAGGAGCAGGGAGGGAGGG + Intergenic
1036664663 8:10730663-10730685 CCGGGAGGAGGACGGAGGGAGGG + Intronic
1036807928 8:11847864-11847886 CACGGAGAAGACCTGGGGCAAGG + Intronic
1037308983 8:17535295-17535317 CAGTGAGAAGGAGGGCGGGAGGG - Intronic
1037476938 8:19267195-19267217 AAGGGAGAAGAGTGGGAGGAGGG + Intergenic
1037805413 8:22055820-22055842 AATGGAGAAGCACAGGGGGAGGG - Intronic
1037805972 8:22058023-22058045 CAGGGAGAGGACCGGTGGGTGGG + Intronic
1037898806 8:22675687-22675709 CAGGAAGGACAACGGGGGGCTGG + Intergenic
1037985168 8:23286455-23286477 TAGGGACAAGCACCGGGGGAAGG - Intronic
1038423795 8:27451679-27451701 CAGGGAGAGGAATGGGGTGGAGG - Intronic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1039583766 8:38688073-38688095 AAAGGAGAAGAAGGGAGGGAGGG + Intergenic
1039905857 8:41785958-41785980 CAGGGAGAAGAGACGCGGGAGGG - Intronic
1040517127 8:48144432-48144454 CAGGGTGAAGAGCGGAGGGGAGG + Intergenic
1040843937 8:51815400-51815422 TAGGGGGAAGAACGGGAGGGGGG + Intergenic
1041077896 8:54185928-54185950 CAGGGAGAAGCCCTGGGGGATGG + Intergenic
1041192964 8:55372050-55372072 CAGGGAGAGGAGCGGGGTCATGG + Intronic
1042384233 8:68154104-68154126 CAGGAAGGAGAACAGTGGGATGG - Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1042815064 8:72869131-72869153 CAGAGATAAGAACTGGGGTATGG + Intronic
1043161930 8:76856230-76856252 CGGGGAGAAGGACTGGAGGAAGG - Exonic
1043319701 8:78968698-78968720 AAGGGAGAAAAGCGGGGAGAGGG + Intergenic
1043956212 8:86362657-86362679 GAGGGAGGAGAAGGGAGGGAAGG + Intronic
1044058730 8:87605714-87605736 CAGGGGGAAGGTGGGGGGGAGGG + Intronic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1045229076 8:100283371-100283393 TAGGGAGAAAAATTGGGGGAGGG - Intronic
1045297854 8:100888000-100888022 AAGGGAGAAGTAGTGGGGGAAGG + Intergenic
1045550880 8:103171283-103171305 AAGAGAGAAGGAAGGGGGGAGGG + Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046720717 8:117615872-117615894 GAGGGAGAAGGAGGGGGAGAGGG - Intergenic
1046729867 8:117713375-117713397 GATGGAGAAGGACGTGGGGAAGG - Intergenic
1046834096 8:118780073-118780095 CAGAGAGAAGGAGGGAGGGAAGG - Intergenic
1046915544 8:119674604-119674626 CCAGGAGAAGAAGAGGGGGAAGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047708533 8:127526368-127526390 CAGGGAGAAGAGTGGAGGGCTGG + Intergenic
1047732065 8:127736168-127736190 CGGGAAAAAGAACGGAGGGAGGG + Exonic
1051681394 9:19611380-19611402 GAGGGAGAGGAAGGAGGGGAAGG + Intronic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1053020590 9:34691395-34691417 CAGGGGGAAGAAGGGGGGCAGGG - Intergenic
1053070793 9:35100764-35100786 TACGGAGAAGAAGGGGGGGATGG + Intronic
1053329160 9:37188492-37188514 GAGGGGGAAGGAAGGGGGGAGGG - Intronic
1053441700 9:38121431-38121453 CAGGGACAGGAAGGGTGGGAGGG + Intergenic
1055224450 9:73977443-73977465 TAGCCAGAAGAACGGGAGGAAGG + Intergenic
1055659213 9:78485352-78485374 CAGGGAGAAAACAGGAGGGAAGG - Intergenic
1055770604 9:79713207-79713229 CAGAGAGGAGAATGAGGGGAAGG + Intronic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1057752364 9:97803279-97803301 CAGAGAGAAGGAAGGCGGGAGGG + Intergenic
1057825907 9:98371923-98371945 CAGGAAGAAGGAAGGGAGGAGGG - Intronic
1058181525 9:101806256-101806278 CAGGGAGAGTAACGTGGGGGTGG + Intergenic
1058474690 9:105320016-105320038 TAGGGACAAGAATGGGGGCAAGG - Intronic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1058957542 9:109963134-109963156 CAAGGAGAAGACCCAGGGGAGGG + Intronic
1059063750 9:111060526-111060548 AGGGGAGAAGAAGGGAGGGAAGG + Intergenic
1059511487 9:114852270-114852292 TGGGGAGAAGGTCGGGGGGAGGG - Intergenic
1059512861 9:114865448-114865470 CAGGGAGTAGAAGAGGGGGAAGG + Intergenic
1059877578 9:118652644-118652666 AAGGAAGAAGAAGGGAGGGAAGG + Intergenic
1059996991 9:119920682-119920704 GAGGGAGAAGAATGGGGAAAGGG - Intergenic
1060156973 9:121326754-121326776 CAGGCACAGGAACGGGGGCAGGG + Intronic
1060258549 9:122053682-122053704 CAGGGAGCAGGGCTGGGGGAAGG + Intronic
1060470719 9:123945885-123945907 CAGGGAAAAGGGCGAGGGGAAGG + Intergenic
1060686800 9:125622128-125622150 CTGGGAGAAGTATGGGGAGATGG + Intronic
1061404812 9:130387659-130387681 CAGTGGGAAGAACGGGCTGAGGG + Intronic
1061427319 9:130507369-130507391 CAGGGAGAGGGACAGGGAGAGGG + Intergenic
1061594832 9:131622054-131622076 CTGTGGGAAGAATGGGGGGAGGG - Intronic
1061762370 9:132859594-132859616 AAGGGAGGAGAAGGGGGAGAGGG - Intronic
1061865659 9:133490755-133490777 CAGGGAGAAGAAGGAGGAGGAGG + Intergenic
1062008511 9:134254387-134254409 GAGGGAGAAGGAGGGAGGGAGGG + Intergenic
1062215057 9:135384603-135384625 CAGGGAGAGGCAGGGGCGGAAGG - Intergenic
1062295432 9:135822808-135822830 AAGGAGGATGAACGGGGGGAAGG - Exonic
1062340936 9:136093786-136093808 CCGGGAGAAGAAGGGGTGGGTGG + Intronic
1062588672 9:137263349-137263371 AAGGGAGAAGGAGGGAGGGAGGG - Intronic
1203654155 Un_KI270752v1:7479-7501 CAGGGAAAACAAGGGAGGGAAGG + Intergenic
1185523785 X:761335-761357 GAAGGAGAAGTACGGGGAGAAGG - Intergenic
1185708456 X:2282600-2282622 GAGAGAGAAGAAAGAGGGGAGGG + Intronic
1185869225 X:3649796-3649818 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1185918111 X:4058761-4058783 CAGAGAGGAGAACAGGGGCAGGG + Intergenic
1186079269 X:5912827-5912849 CAGGGAGAGGGAAGGAGGGAAGG + Intronic
1186239979 X:7555369-7555391 AAGGGAGAAGAGAGGAGGGAAGG + Intergenic
1186413376 X:9362771-9362793 GAGAGAGAGGAACGGCGGGAAGG + Intergenic
1187388929 X:18873167-18873189 AAGGGAGAATAACGGGAGCATGG + Intergenic
1187825902 X:23333716-23333738 CAGGGCGAAGAACCGGGAGCCGG + Intergenic
1187882916 X:23862949-23862971 AAGGGAGAAGGAGGGAGGGAGGG + Intronic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1189465771 X:41276517-41276539 CGGGGAGAAGAAGAGAGGGAGGG + Intergenic
1190472996 X:50801223-50801245 GAGGGAGAAGGAGGGAGGGAAGG + Intronic
1190634088 X:52417594-52417616 CAGGGAGCGGGGCGGGGGGAAGG + Intergenic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1192240550 X:69324444-69324466 AAGGGAGAAGAACTGGGTTATGG + Intergenic
1192459493 X:71304772-71304794 AAGGGAGAAGGAAGAGGGGAGGG - Intronic
1192717955 X:73663760-73663782 CAGGGAAAAGAAAGGGGAAAGGG - Intronic
1193501800 X:82285437-82285459 GAGAGGGAAGAACGGAGGGAAGG + Intergenic
1193792720 X:85835252-85835274 AAGAGAGAAGAAGAGGGGGAGGG + Intergenic
1194100713 X:89700265-89700287 AAGGAAGAAGAAAGGGGAGAGGG - Intergenic
1195299106 X:103509548-103509570 GAGGGAGAGGAAGAGGGGGATGG - Intronic
1197761370 X:130030695-130030717 CTGGGGGAGGAACAGGGGGAAGG - Intronic
1198443186 X:136684557-136684579 CAGAGAGAAGCCCGGGGGGTGGG - Intronic
1198502990 X:137271111-137271133 CAGGGAGAAGAGGGAAGGGAGGG + Intergenic
1199320140 X:146428297-146428319 CAGGGAGAAGAAGGGTGGTGTGG - Intergenic
1199618806 X:149680931-149680953 CAGGGAAAAGAAAGGGGAAAGGG - Intergenic
1199623836 X:149722318-149722340 CAGGGAAAAGAAAGGGGAAAGGG + Intergenic
1200089732 X:153628818-153628840 CAGGGCCAAGAGCCGGGGGAGGG + Intergenic
1200453666 Y:3361341-3361363 AAGGAAGAAGAAAGGGGAGAGGG - Intergenic
1200839884 Y:7770542-7770564 GAGGCAGAAAAACAGGGGGAAGG - Intergenic
1201146150 Y:11066643-11066665 AAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146291 Y:11067104-11067126 AAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146330 Y:11067206-11067228 CAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146393 Y:11067418-11067440 AAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146506 Y:11067790-11067812 GAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146531 Y:11067864-11067886 GAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146569 Y:11067972-11067994 GAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201146588 Y:11068030-11068052 GAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201515215 Y:14812990-14813012 CAGGGAGAGGGAAGGTGGGAGGG - Intronic
1201751494 Y:17436639-17436661 CAGTGAGATGAATGGGGAGATGG + Intergenic
1202060989 Y:20887614-20887636 CAGGGGTGAGAACTGGGGGAGGG + Intergenic