ID: 1052050507

View in Genome Browser
Species Human (GRCh38)
Location 9:23842422-23842444
Sequence GGAGGCTGGTTTTCTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052050507_1052050512 3 Left 1052050507 9:23842422-23842444 CCTGTTGCAGAAAACCAGCCTCC No data
Right 1052050512 9:23842448-23842470 AGAATCTACTTTCTGACTCATGG No data
1052050507_1052050513 16 Left 1052050507 9:23842422-23842444 CCTGTTGCAGAAAACCAGCCTCC No data
Right 1052050513 9:23842461-23842483 TGACTCATGGCCAGATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052050507 Original CRISPR GGAGGCTGGTTTTCTGCAAC AGG (reversed) Intergenic
No off target data available for this crispr